From wsi Tue Jan 5 11:56:34 1993 Subject: fuzzy-mail: Uncertainty Digest, 4 Jan 1993 (fwd from uncertainty-researchers List maintained by John Mark Agosta ) Uncertainty Digest Monday, January 4th 1993 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ~ The uncertainty list is a means for researchers in uncertainty reasoning ~ to exchange information, such as conference announcements, articles, ~ opinions, reviews, and software. ~ ~ ~ This issue contains four announcements, one for a special issue of ~ IEEE SMC, the rest for uncoming conferences. I have included the ~ last announcement on planning, which has not seen traditionally ~ strong participation from the uncertainty community. It recently ~ has attracted some interest in the community, and may be a possible ~ area for cross-fertilization. ~ ~ ~ Please send all submissions and correspondence, as well as requests ~ for changes to the mailing list to agosta@sumex-aim.stanford.edu. ~ Archives may be found by anonymous ftp to sumex-aim.stanford.edu ~ in /var/ftp/pub/unc ~ ~ ~ This list is maintained by John Mark Agosta, 415/859-4931. Please ~ send mail not related to the list to johnmark@sri.com. ~ ~ ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Today's Topics: Call for papers: Knowledge-Based Construction of Probabilistic and Decision Models Call for participation: 31st Annual Bayesian Research Conference The Management of Uncertainty in AI Second European Workshop on Planning (EWSP'93) ________________________________________________________________ Call for Papers, for a special section of IEEE Transactions on Systems, Man, and Cybernetics on: Knowledge-Based Construction of Probabilistic and Decision Models ================================================================= To be edited by 3 guest editors: Michael P. Wellman, University of Michigan John S. Breese, Microsoft Research Labs Robert P. Goldman, Tulane University This special section will be devoted to the emerging area of research on the dynamic construction of probabilistic and decision models from knowledge bases. This topic is gaining increasing attention from AI researchers, spurred by significant advances in representation and computation with graphical modeling formalisms (i.e., influence diagrams and causal probabilistic networks). In applying these techniques to AI problems such as planning and diagnosis, model construction has proven to be a serious bottleneck, and hence numerous researchers have sought to automate this process. Indeed, for some broad tasks, such as natural language understanding and robotics, dynamic model construction appears to be the only feasible approach to exploit the new graphical technologies. By knowledge-based model construction, we refer to techniques that apply general knowledge to specific problem instances by automatically generating models customized for the particular query or decision situation. Approaches may differ in the form in which general knowledge is represented, in the target modeling languages (for example, influence diagrams, belief networks, decision trees, or mathematical programming models), or in the process of model construction. The aim of this special section is to collect contributions in each of these areas, thus serving to solidify knowledge-based model construction as a coherent research topic, and to make available to a wider audience the achievements and new ideas derived from work to date. Specifically, we solicit papers describing new techniques for dynamic model construction, significant application of model construction to probabilistic reasoning and decision-making tasks, and insightful analysis of the model construction process. Background The genesis of this special section was the AAAI-91 Workshop on the same topic (organized by the editors), which brought together researchers from both the AI and Decision Analysis communities to share their ideas and experiences with the problem of automatic model construction. Presentations brought to the fore some fundamental issues that have arisen in research conducted along a range of methodologies and perspectives. Many attendees expressed enthusiasm about the convergence of diverse research efforts toward a well-defined goal, and about the abundance of promising ideas and strategies being pursued. Continuing enthusiasm was demonstrated by the presentation of at least six papers on this topic at the 1992 Conference on Uncertainty in AI, and the favorable feedback received on the pace of progress in this area. Why IEEE SMC? The enterprise of knowledge-based model construction takes as fundamental a systems-oriented perspective on decision-modeling technology. Rather than regard the models as static, isolated objects, this approach recognizes the larger context of background knowledge and special circumstances that are present in any application of modeling to real-world decision making. This view is highly congruent with the characterization of SMC's scope as described in the recent "Past, Present, and Future" article appearing in the transactions. As research in model construction spans activities in knowledge-based systems, uncertain reasoning, decision analysis, and artificial intelligence, it addresses the interests of a large segment of the SMC society's membership. Submission Requirements: To be considered for the special section, five copies of each paper must be received by one of the editors at the addresses below by June 1, 1993. The first page should include a descriptive title, the names and addresses of all authors, a brief abstract, and salient keywords or other topic indicators. Submissions will be carefully refereed for technical contribution, practical significance, and clarity of presentation (according to the standard IEEE Transactions criteria), as well as salience to the topic of knowledge-based model construction. Conciseness will also be an important factor, as space for this section will be limited to approximately 100 Transactions pages. Notifications will be sent by Sept 1, 1993, and final versions of accepted papers will be due two months later. Expected publication is mid-1994. Michael P. Wellman University of Michigan Artificial Intelligence Laboratory 1101 Beal Avenue Ann Arbor, MI 48109-2110 wellman@eecs.umich.edu (313) 764-6894 John S. Breese Microsoft Research Labs One Microsoft Way Building 9S/1024 Redmond, WA 98052-6399 Robert P. Goldman Tulane University Computer Science Dept 301 Stanley Thomas Hall New Orleans, LA 70118-5698 rpg@cs.tulane.edu (504) 865-5840 ________________________________________________________________ Invitation to 31st Annual Bayesian Research Conference (These are excerpts from the flyer I received in the mail:\ -jma) Those familiar with this Conference know it for its informal atmosphere. The conference is a good place to try out new ideas on a kindly, knowledgable and critical audience. No proceedings are published, and the organization of talks is often determined at as the day unfolds. The dates this year are February 11 and 12, 1993. It meets again this year at the Sportman's Lodge, in Studio City (Los Angeles) California. The format and purpose are the same this year as in previous years. Conferees give 30-miniute papers to one another about research on inference, evaluation, decision processes and problems. The conference strives for a blend of basic research and applications. A mixture of behavioral and normative interests has characterized the conference over the years. This means that decision analysts and behavioral decision theorists will be talking to one another. In recent years a number of members of the Normative AI Systems community have been atending. So in addition to familiar topics like utility, probability, cognitive illusions, and the like, discussion will also center on influence diagrams, formal representations of uncertainty, utility theory as a basis for control, Normative Systems as competitors to expert systems, and similar topics. (Ward Edwards, who organizes this conference, does not (yet) have e-mail registration for the conference. Please contact him for a registration form, to be returned by January 28th, and I am sure he will be happy to mail you one. Sorry, it is too tedious to retype the entire thing for distribution. -jma) Ward Edwards University of Southern California Social Science Research Institute University Park Los Angeles, CA 90089-1111 Tel: (213)740-4252 Fax: (213)746-2977 ________________________________________________________________ Call for Papers IJCAI-93 Workshop The Management of Uncertainty in AI ================================== Ph. Smets, P. P. Bonissone, D. Dubois, D. Gabbay, M. Henrion, D. Pool, and H. Prade. The need for techniques to cope with uncertainty has been acknowledged by the AI community in order to cope with commonsense reasoning. Such an enterprise could only succeed if uncertainty is mastered by appropriate models. When implementing approximate reasoning tools, a danger is to use inappropriate or unjustified models. Newcomers in the domain of uncertainty are often overwhelmed by the multitude of models. Their reaction can be either to accept one of them and force it to every problem, or to use all of them somehow at random. Both attitudes are wrong. The systematic use of a single model is inappropriate as ignorance, uncertainty, incompleteness and vagueness are different concepts. A random usage usually leads to inappropriate matching. Probability theory is the obvious candidates that comes to the mind for modeling uncertainty. Nevertheless, whether it can express all forms of uncertainty is debatable. Other models must be also considered such as Non-Monotonic logics, Possibilistic models, Evidential Models and Fuzzy Logics. The workshop will survey some of the proposed models in a AI perspective, hoping that it might lead potential users to a better understanding of the forms of ignorance. The presentations should focus on the complementarity of the various quantitative and qualitative theories. They should enhance overviews on the respective domains of application of the theories and on the interrelations between them. Papers should be submitted as extended abstracts (about 4 pages). No email submission. Schedule: ======== Five copies of each paper should be sent to the Workshop Coordinator by March 1, 1993. Papers acceptance by April 1, 1993. Final papers delivered by June 1, 1993. Workshop Coordinator =================== Philippe Smets, IRIDIA, Universite Libre de Bruxelles 50 Av. Roosevelt, CP 194/6, 1050 Brussels, Belgium tel. 32-2-650-27-29 fax: 32-2-650-27-15 email: psmets@ulb.ac.be ---------------------------------------------------------------------- Second European Workshop on Planning (EWSP'93) Dec. 9-11, 1993, near Linkoping, Sweden Call for Papers There are many research groups working on AI planning and related topics all over Europe. The workshop is primarily intended to strengthen the connections between these groups and to provide a forum for the exchange of ideas and results. It is also intended to act as a complement to the American planning workshops arranged by DARPA, AAAI etc. However, submissions from non-European countries are also welcome. The first European Workshop on Planning (EWSP'91) took place in St. Augustin, Germany in March 1991. Although there is a newly established international conference on AI planning systems, there is still a need for a European workshop on this subject. Workshop details: ----------------- Participation will be by invitation only and the number of participants will be limited to a maximum of approx. 75 persons. The plan is to publish the workshop proceedings at an international publishing house shortly after the workshop. The workshop is planned to take place at a conference hotel in the neighbourhood of Linkoping, Sweden (the exact location is not yet decided). Submissions and participation: ------------------------------ Original papers in English are invited in all areas of AI planning and related topics. Areas include, but are not limited to, the following: - Classical AI planning - Planning for concurrent actions - Prediction and plan validation - Planning under uncertainty - Planning and knowledge - Scheduling - Decision-theoretic planning - Multi-agent planning - Reactive systems Papers are welcome in the whole spectrum from practical and applied research to theoretical research and we especially welcome papers combining these aspects. Papers should be written in 12pt type, using high-quality printers (exceptions will be made for countries where such printers are not widely available), on A4 paper (or similar format, if A4 papers are not available). Papers should have a front page containing: title; name, full address, email address and fax # (if available) for all authors; keywords and a 100-200 word abstract. Papers must not exceed 12 pages, excluding front page and references. Five (5) hardcopies of papers must reach the programme chairman not later than June 1st, 1993. Notification of acceptance/rejection will be mailed to the first (or designated) author of each paper by Oct. 10, 1993. Camera-Ready versions of accepted papers are due Nov. 5, 1993. Accepted papers must be presented at the workshop, in English by one of the authors. Paper submissions should be accompanied with a letter stating whether the authors want to attend the workshop also in the case of rejection of their paper. Applicants wishing to participate but not submit a paper should submit a 1-2 page summary of their research interests, including references. Programme chair: ---------------- Christer Backstrom IDA Linkoping University S-58183 Linkoping SWEDEN email: cba@ida.liu.se (not for submissions) fax: +46 13 282606 (not for submissions) Programme committee: -------------------- Giovanni Adorni, U. di Parma, Italy Christer Backstrom, Linkoping U., Sweden Malik Ghallab, LAAS/CNRS, Toulouse, France Joachim Hertzberg, GMD, St. Augustin, Germany Hermann Kaindl, Siemens AG, Vienna, Austria Bernhard Nebel, DFKI, Saarbrucken, Germany Erik Sandewall, Linkoping U., Sweden Josef Schneeberger, FORWISS, Erlangen, Germany Sam Steel, U. of Essex, Great Britain Austin Tate, AIAI, Edinburgh, Great Britain The workshop is sponsored by: ----------------------------- - Gesellschaft fur Informatik (GI), Germany - Swedish sources ________________________________________________________________ end of uncertainty list, 5 January 1993 From wsi Tue Jan 5 18:13:59 1993 Subject: fuzzy-mail: archives and statistics The European FUZZY-MAIL-LIST has an archive where all previous messages are recorded up to the respective last Sunday morning. To retrieve for example the currently last archive, send the command get fuzzy-mail archive 3 to the address listserv@vexpert.dbai.tuwien.ac.at Additionally, the command statistics (also to be sent only to the address listserv@vexpert.dbai.tuwien.ac.at) that was previously disabled has now been enabled. Nevertheless, please do not abuse it since it may use a lot of CPU resources. Best regards and a happy and successfull New Year, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send "subscribe fuzzy-mail Your Real Name" as a message to | | listserv@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like "help" to listserv@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Ms. Heidi MILOS at +43-1-5055304 From wsi Tue Jan 5 18:38:26 1993 Subject: Re: fuzzy-mail: archives and statistics > Additionally, the command > > statistics > > (also to be sent only to the address > listserv@vexpert.dbai.tuwien.ac.at) that was previously disabled has > now been enabled. Nevertheless, please do not abuse it since it may use > a lot of CPU resources. Sorry, the correct syntax is of course statistics fuzzy-mail Currently, the system will answer with something like: ----- Begin Included Message ----- Here are the number of messages per subscriber: WSI@VEXPERT.DBAI.TUWIEN.AC.AT 8 K312570@ALIJKU11.BITNET 0 VDWALLE@BMLSCK11.BITNET 1 STOHL@VAIETA.VAI.CO.AT 1 ROMAN@ECE.TUWIEN.AC.AT 0 MORITZ@RISC.UNI-LINZ.AC.AT 0 KALCHER@PBOX.JOANNEUM.AC.AT 0 ROBERT@ICT.TUWIEN.AC.AT 0 RICHARD@BUGGI.OR.RWTH-AACHEN.DE 1 BENEDIKT@ZDVAXA.UNA.AC.AT 0 OK@IERT.TUWIEN.AC.AT 0 ES_ANDLI@RCVIE.CO.AT 0 STEIFR1@AWIIMC12.IMC.UNIVIE.AC.AT 0 ADLAPE1@AWIIMC12.IMC.UNIVIE.AC.AT 0 VW@SYS.TITECH.AC.JP 0 ZULIANG@ISS.NUS.SG 2 NAKATSU@EA5.YZ.YAMAGATA-U.AC.JP 1 NAUCK@IBR.CS.TU-BS.DE 0 KRUSE@IBR.CS.TU-BS.DE 0 BONARINI@IPMEL2.ELET.POLIMI.IT 1 BOUCHON@LAFORIA.IBP.FR 1 ES_FUCHS@RCVIE.CO.AT 0 LU@SWTM1.TUWIEN.AC.AT 0 KLAWONN@IBR.CS.TU-BS.DE 0 P.CHEUNG@IMPERIAL.AC.UK 0 BONISSON@SOL.CRD.GE.COM 0 OHARA%PAV.MCC.COM@MCC.COM 0 COMLY@SOL.CRD.GE.COM 0 PETERS@BALI.GMD.DE 0 TIL.COM!TANAKA@TIL.COM 0 GEBHARDT@GMDZI.GMD.DE 1 WOLFGANG_EPPLER@FZI.DE 0 GWAGNER@GMDZI.GMD.DE 1 BOROWIEC@KARLSRUHE.GMD.DE 0 HAERTIG@GMDZI.GMD.DE 0 MES@GMDZI.GMD.DE 0 SANCHEZ@IMT950.IMT-MRS.FR 0 @PRG.OXFORD.AC.UK:HJE@ROBOTS.OXFORD.AC.UK 1 LUIHC@ISS.NUS.SG 0 ARRAS@FORWISS.UNI-ERLANGEN.DE 0 VANGELIS@KSUVM.KSU.EDU 0 H1256KOC@ELLA.HU 0 GUO@RHUM.GMD.DE 2 LIYA@ISS.NUS.SG 0 TIL.COM!VIVIAN@TIL.COM 0 RIEGER%UTRURT.UUCP@GERMANY.EU.NET 0 ABERZIGA@EMAIL.TUWIEN.AC.AT 0 FANKHAUS@DARMSTADT.GMD.DE 0 K3005E0@ALIJKU11.EDVZ.UNI-LINZ.AC.AT 0 BDB@CAGE.RUG.AC.BE 0 BR1STAG2@BMLSCK11.BITNET 0 EINA@CCVAX.UNICAMP.BR 0 KHEDKAR@DIVA.BERKELEY.EDU 0 CASA@AGRCLU.ST.IT 0 SAMSEGGER@KAPSCH.CO.AT 0 TAKAGI@DIVA.BERKELEY.EDU 0 KRASLAWSKI@HAULI.LUT.FI 0 @HUEARN.SZTAKI.HU:H1367FOD@ELLA.HU 0 MOUADDIB@LORIA.LORIA.FR 0 I7110205@DBSTU1.RZ.TU-BS.DE 0 GEYERS@UXE.WU-WIEN.AC.AT 0 MALAVIYA@NICOBAR.GMD.DE 0 Total number of messages on file: 28 ----- End Included Message ----- From fuzzy-mail@vexpert.dbai.tuwien.ac.at Wed Jan 6 11:13:56 1993 Date: Wed, 6 Jan 93 11:13:24 +0100 From: hje@robots.oxford.ac.uk Subject: IEE Colloquium on Fuzzy Control CALL FOR PAPERS Two decades of Fuzzy Control It it almost twenty years since the first papers on fuzzy control were published. Since then, fuzzy control and fuzzy reasoning have had a chequered history, with little acceptance in the first decade, but widespread application during the eighties, most notably in Japan. Current applications range from consumer goods, such as cameras and washing machines, to safety critical installations, such as nuclear power plants and subway systems. This colloquium will review the use of fuzzy control and fuzzy reasoning in the UK and Europe. Fuzzy control and neural nets are becoming closely related through recent work on the underlying theories of both subjects, and applications which meld the properties of both. Fuzzy control is extending upwards from hardware devices to high level decision-making at a supervisory level. Papers are invited on all aspects and applications of fuzzy reasoning in industry, the military, medicine, management etc. A one-day colloquium on fuzzy control will be held at the Institution of Electrical Engineers, London on Wednesday 19 May 1993. Prof E.H. Mamdani, the founder of the field of fuzzy control, will give the opening talk. Papers are invited on all aspects and applications of fuzzy reasoning in industry, the military, medicine, management etc. Prospective authors should send an abstract, before Friday 19 February 1992, to Dr H J Efstathiou, Department of Engineering Science, University of Oxford, Oxford OX1 3PJ, UK. Tel +44-865-273148, fax +44-865-273908, e-mail: hje@uk.ac.ox.robots From fuzzy-mail@vexpert.dbai.tuwien.ac.at Sat Jan 9 05:03:18 1993 Date: Sat, 9 Jan 93 05:02:51 +0100 From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: IRTICS'93 Subject: IRTICS'93 ------------------------------------------------------------------- Date: Thu, 7 Jan 93 17:02:40 -0100 From: "Luis B. Almeida" Subject: workshop announcement IRTICS'93 CALL FOR PAPERS Workshop on Integration Technology for Real-Time Intelligent Control Systems October 5-7, 1993 Madrid, SPAIN Sponsored by: The Commission of the European Communities (CEC) The HINT project Organized by: Instituto de Ingenieria del Conocimiento (IIC) AIM: ---- Nowadays, the necessity of using together several techniques in order to improve the benefits of real-time intelligent control systems has become a constant in most industrial environments. Expert systems, neural networks, modelization, etc... can solve problems but, in many cases, a solution that partly involves different techniques leads to synergistic effects. So, cooperation among different approaches has become a crucial area of interest in this environment,the objective being to get common frameworks where you can use the best of each technique as effectively as possible. This certainty moved us to the present workshop on "Integration for Real-Time Intelligent Control Systems", IRTICS'93, that we are sure will be a good opportunity of examining many of the possibilities that exist, or will exist, in this direction. This workshop aims to encourage the communication and exchange of ideas among researchers, practitioners and end-users aware of the possibilities of integrating different AI technologies in real-time environments. Contributions addressing both theoretical problems and practical experiences will be of great interest for this forum. The workshop is organized by the Instituto de Ingenieria del Conocimiento, IIC, as an external activity of the HINT project: Heterogeneous Integration Architecture for Intelligent Control Systems (ESPRIT 6447). All the correspondence about the workshop should be addressed to the Workshop Secretariat at the IIC. TOPICS: ------- Researchers and practitioners interested in the possibilities of integration among different techniques applied to real-time environments, so as specific works that could be synergiistically enforced by means of integration, are invited to participate in the workshop by submitting an extended abstract as specified. Suggested topics include Integration Techniques for: * Expert Systems * Neural Networks * Fuzzy Logic * Model Based Reasoning * AI Architectures * Intelligent User Support Systems SUBMISSION REQUIREMENTS: ------------------------ Authors should submit 3 copies of an extended abstract (max 2000 words, approximately 5 single spaced pages) to the secretariat of the workshop before the deadline indicated in the timetable. They should include separately a page containing their name and full address, e-mail, fax or telephone, and the section(s) their work is related to. All contributions should be submitted in English. Abstracts will be reviewed according to their relationship with the basic aim of the workshop, their clarity and originality. Accepted papers will be included in a book to be published with the results and conclusions of the workshop. PROGRAMME: ---------- The programme of the workshop will include three different activities: * Invited Contributions * Communications * Discussions We plan to include invited contributions about some state-of-the-art themes that are of interest for all the participants. The rest of the time, parallel sessions will be held about each topic, including communications and a long time for discussions. The last of these sessions will deal with 'integration' as the main topic of the workshop. Participants are invited to summarize the results of their work in this final session. TIMETABLE: ---------- * Submissions must be received: by February 28, 1993. * Notification of acceptance or rejection: by April 30, 1993. * Camera-Ready versions: before June 30, 1993. REGISTRATION FEES: ------------------ The registration fees include midday lunch during the workshop, a Welcome Party to be held on Monday 4th evening and the proceedings of the workshop. Registration: 400 ECU ORGANIZATION COMMITTEE: ----------------------- Enrica Chiozza (IIC, Spain) Pilar Rodriguez-Marin (IIC, Spain) PROGRAM COMMITTEE: ------------------ Fontaine L. (Dassault Electronique, France) Rodriguez-Marin P. (IIC, Spain) Almeida L. B. (INESC, Portugal) Sundin U. (INFOLOGICS, Sweden) De Pablo E. (Repsol Petroleo, S.A., Spain) Jimenez A. (UPM, Spain) SECRETARIAT: ------------ Enrica Chiozza Instituto de Ingenieria del Conocimiento UAM Canto Blanco Modulo C-XVI, P. 4 28049 Madrid SPAIN Fax: (34 1) 397 3972 Phone: (34 1) 397 8520 E-mail: CHIOZZA @ EMDCCI11.BITNET CHIOZZA @ iic.uam.es ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ From fuzzy-jp@prec.osaka-u.ac.jp Mon Jan 11 05:40:01 1993 Date: Mon, 11 Jan 93 13:28:53 JST From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: IRTICS'93 Subject: IRTICS'93 ------------------------------------------------------------------- Date: Thu, 7 Jan 93 17:02:40 -0100 From: "Luis B. Almeida" Subject: workshop announcement IRTICS'93 CALL FOR PAPERS Workshop on Integration Technology for Real-Time Intelligent Control Systems October 5-7, 1993 Madrid, SPAIN Sponsored by: The Commission of the European Communities (CEC) The HINT project Organized by: Instituto de Ingenieria del Conocimiento (IIC) AIM: ---- Nowadays, the necessity of using together several techniques in order to improve the benefits of real-time intelligent control systems has become a constant in most industrial environments. Expert systems, neural networks, modelization, etc... can solve problems but, in many cases, a solution that partly involves different techniques leads to synergistic effects. So, cooperation among different approaches has become a crucial area of interest in this environment,the objective being to get common frameworks where you can use the best of each technique as effectively as possible. This certainty moved us to the present workshop on "Integration for Real-Time Intelligent Control Systems", IRTICS'93, that we are sure will be a good opportunity of examining many of the possibilities that exist, or will exist, in this direction. This workshop aims to encourage the communication and exchange of ideas among researchers, practitioners and end-users aware of the possibilities of integrating different AI technologies in real-time environments. Contributions addressing both theoretical problems and practical experiences will be of great interest for this forum. The workshop is organized by the Instituto de Ingenieria del Conocimiento, IIC, as an external activity of the HINT project: Heterogeneous Integration Architecture for Intelligent Control Systems (ESPRIT 6447). All the correspondence about the workshop should be addressed to the Workshop Secretariat at the IIC. TOPICS: ------- Researchers and practitioners interested in the possibilities of integration among different techniques applied to real-time environments, so as specific works that could be synergiistically enforced by means of integration, are invited to participate in the workshop by submitting an extended abstract as specified. Suggested topics include Integration Techniques for: * Expert Systems * Neural Networks * Fuzzy Logic * Model Based Reasoning * AI Architectures * Intelligent User Support Systems SUBMISSION REQUIREMENTS: ------------------------ Authors should submit 3 copies of an extended abstract (max 2000 words, approximately 5 single spaced pages) to the secretariat of the workshop before the deadline indicated in the timetable. They should include separately a page containing their name and full address, e-mail, fax or telephone, and the section(s) their work is related to. All contributions should be submitted in English. Abstracts will be reviewed according to their relationship with the basic aim of the workshop, their clarity and originality. Accepted papers will be included in a book to be published with the results and conclusions of the workshop. PROGRAMME: ---------- The programme of the workshop will include three different activities: * Invited Contributions * Communications * Discussions We plan to include invited contributions about some state-of-the-art themes that are of interest for all the participants. The rest of the time, parallel sessions will be held about each topic, including communications and a long time for discussions. The last of these sessions will deal with 'integration' as the main topic of the workshop. Participants are invited to summarize the results of their work in this final session. TIMETABLE: ---------- * Submissions must be received: by February 28, 1993. * Notification of acceptance or rejection: by April 30, 1993. * Camera-Ready versions: before June 30, 1993. REGISTRATION FEES: ------------------ The registration fees include midday lunch during the workshop, a Welcome Party to be held on Monday 4th evening and the proceedings of the workshop. Registration: 400 ECU ORGANIZATION COMMITTEE: ----------------------- Enrica Chiozza (IIC, Spain) Pilar Rodriguez-Marin (IIC, Spain) PROGRAM COMMITTEE: ------------------ Fontaine L. (Dassault Electronique, France) Rodriguez-Marin P. (IIC, Spain) Almeida L. B. (INESC, Portugal) Sundin U. (INFOLOGICS, Sweden) De Pablo E. (Repsol Petroleo, S.A., Spain) Jimenez A. (UPM, Spain) SECRETARIAT: ------------ Enrica Chiozza Instituto de Ingenieria del Conocimiento UAM Canto Blanco Modulo C-XVI, P. 4 28049 Madrid SPAIN Fax: (34 1) 397 3972 Phone: (34 1) 397 8520 E-mail: CHIOZZA @ EMDCCI11.BITNET CHIOZZA @ iic.uam.es ++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++ From fuzzy-mail@vexpert.dbai.tuwien.ac.at Sun Jan 10 11:57:22 1993 Date: Sun, 10 Jan 93 11:56:52 +0100 From: PEKLUND@finabo.abo.fi Subject: MEPP 93 seminar announcement **************************************** **************************************** ********** M E P P '93 ************* **************************************** **************************************** International Seminar on Diagnostics and Control through Neural Interpretations of Fuzzy Sets Mariehamn, AAland, June 14-18, 1993 *** The MEPP seminars were initiated by Aldo Ventre in 1990, with the first seminar organized in Ischia, October 7-11, 1990. The seminars bring people to a discussion on efforts and consequences of bridging the gap between successful fuzzy systems applications and supporting foundational developments. A leading subtitle also for MEPP 91 and MEPP 92 was "diagnostics and control through neural interpretations of fuzzy sets", covering applications in medical diagnostics and process control. In these areas, the MEPP seminars respect engineering approaches, involving know-how and skill required for putting things to work, paradigmic approaches, focusing on development of relevant tools and techniques which support the engineering process, and foundational approaches, pinpointing relevant framework thereby guiding the development process. The MEPP 92 seminar held in Mariehamn, AAland Islands, June 15-19, 1992, drew the attention of 30 participants from Austria, Belgium, Finland, Germany, New Zealand, Norway, Russia and USA. Proceedings of MEPP 92 are available. *** Program Committee Miguel Delgado, Spain Patrik Eklund, Finland, chairman Mario Fedrizzi, Italy Jari Forsstroem, Finland Robert Fuller, Hungary Frank Klawonn, Germany Peter Klement, Austria Aldo Ventre, Italy Jose Verdegay, Spain Ron Yager, USA The forthcoming seminar will continue focusing on paradigms for inference with topics including + structures of fuzzy sets + basic concepts and tools + fuzzy logic + neural fuzzy systems + diagnostics and control + medical applications + decision support Authors are invited to submit papers for the conference. Extended abstracts must not exceed 10 pages, and should be received before April 30, 1993. For more information, please contact Patrik Eklund Abo Akademi University Department of Computer Science LemminkŠinengatan 14 SF-20520 ABO Finland fax +358-21-654732 phone +358-21-654684 (654475) e-mail peklund@finabo.abo.fi *** Seminar site is Hotel Arkipelag in Mariehamn, capital of AAland. The islands are located between the Finnish and Swedish mainlands. An opening session will be held on Monday, June 14, on M/S Amorella (from Abo/Turku to Mariehamn). A post-seminar discussion will be arranged on Friday afternoon, June 18, on M/S Kalypso (Mariehamn to Abo). You can reach Mariehamn by + direct flights from Abo, Helsinki and Stockholm + ferries from Abo and Stockholm Participants are recommended to arrive in and depart from Abo, thus joining us for the opening and closing session on the luxurious ferries in our beautiful Aland archipelago. If you intend to participate, please return the non-binding pre-registration form as soon as possible. *** PRELIMINARY REGISTRATION Name: _____________________________________________ Organization: _______________________________________ Address: ___________________________________________ ____________________________________________________ Fax: ____________ E-mail: _________________________ Title of abstract: _____________________________________ ____________________________________________________ Estimated arrival In: ____________________ Date: __________________ Estimated departure From: ____________________ Date: __________________ Registration fee: 1.000 FIM , including - ferry trips - conferences lunches and coffee breaks - conference dinner - preceedings Accomodation (please mark your choices): MARIEHAMN: At Hotel Arkipelag, a conference hotel in the center of Mariehamn, single rooms are available at the price of 400 FIM/night (incl breakfast and morning sauna). [ ] "standardized" using the ferries, 4 nights from June 14 to 18 [ ] ___ nights arriving June ___, departing June ____. ABO: At Hotel Keskushotelli, in the center of Abo, rooms are available at the price of 200 FIM/night (incl breakfast). [ ] ___ nights, specify dates (if not according to arrival in and departure from Abo): From til.com!tanaka@til.com Wed Jan 13 20:55:57 1993 Date: Wed, 13 Jan 93 11:26:08 PST From: tanaka@til.com (Yokichi Tanaka) takagi@cs.berkeley.edu, yuki@cs.unc.edu Subject: comp.ai.fuzzy I just wanted to inform you all that a new newsgroup, "comp.ai.fuzzy", has just been created. It's started off with a bang with over 20 posts on this first day. Yoke Tanaka Togai InfraLogic, Inc. tanaka@til.com 714-975-8522 From takagi@diva.Berkeley.EDU Wed Jan 13 22:20:19 1993 Date: Wed, 13 Jan 93 13:18:27 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) takagi@cs.berkeley.edu, tanaka@til.com, yuki@cs.unc.edu Subject: Re: comp.ai.fuzzy Thanks to your information. Yesterday I got this news from Fuzzy Mailing List - Japan. I have used mailing list only; it takes much time for me to check news group. Mailing list of researchers seems higher quality and fewer traffic than news group. But, if you find something which interests us, your forwarding to mailing list will be welcom. Hideyuki TAKAGI From RFULLER@finabo.abo.fi Sun Jan 17 16:43:05 1993 <01GTMTSMNE2890OODH@finabo.abo.fi>; Sun, 17 Jan 1993 17:43:48 EET Date: 17 Jan 1993 17:43:48 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Report from Fuzziness in Finland 1993 (FiF '93) Mime-Version: 1.0 Conference Report: Fuzziness in Finland 1993 On January 15, 1993, a one-day workshop on Fuzzy Logic and Applications sponsored by the GeDeMeDeS project was held on the ferry M/S Kalypso between Sweden and Finland. The organizers were Patrik Eklund of Abo Akademi University and Jorma Mattila of Lappeenranta University of Technology. There were 20 finnish participants and one hungarian, Robert Fuller, who is a visiting researcher at Abo Akademi University. We had three sessions. Morning session (chair: Jorma Mattila) Osmo Kaleva from Tampere University of Technology reviewed some basic tools and methods, which are useful in fuzzy analyis and showed how the space of n-dimensional fuzzy numbers can be embedded into concrete Banach spaces (e-mail: kaleva@rapola.cc.tut.fi). Jorma Mattila from Lappeenranta University of Technology talked about the comparison of two-valued and multi-valued fuzzy logic and demonstrated how they can be used in approximate reasoning (e-mail: mattila@hauli.lut.fi). Vesa Niskanen from University of Helsinki spoke about the advantages of the metric truth approach in fuzzy reasoning systems and illustrated his ideas by concrete cases (e-mail: niskanen@cc.helsinki.fi). Afternoon session (chair: Patrik Eklund) Patrik Eklund of Abo Akademi University and Robert Fuller of Eotvos University of Budapest presented two talks on the foundational description of neuro-fuzzy logic and demonstrated the advantages of prepocessing techniques in Medical Decision Support Systems (e-mails: peklund@finabo.abo.fi and rfuller@finabo.abo.fi). Harri Koskinen from Technical Research Centre of Finland presented a case study on control strategies for active magnetic bearings, with a comparison and integration of classical and fuzzy techniques (e-mail: harri.koskinen@kau.vtt.fi). Jukka Salo from Omron Electronics Oy presented and demonstrated the Omron fuzzy logic product family and overviewed the existing techniques and technologies for fuzzy control (fax: 358-0460-136). Evening session (chair: Vesa Niskanen) Pekka Isomursu from Technical Research Centre of Finland considered the problems related to fuzzy control and fine-tuning and announced the forthcoming report on Fuzziness in Finland distributed by TEKES (e-mail: pekka.isomursu@tko.vtt.fi). Hannu Nurmi from University of Turku showed how fuzzy and rough sets can be used in social choice theory and provided a comperative evaluation of social choice functions (e-mail: hnurmi@gara.utu.fi). Jari Kortelainen from Mikkeli Polytichnic Institute of Business showed how modifiers affect on fuzzy sets and demonstrated his ideas on the Generalized Modus Ponens (fax: 358-55-369-278). Veikko Pohjola from University of Oulu illustrated the growing fuzziness feature of real-time economical estimation processes (e-mail:po-vp@finou.oulu.fi). Esko Turunen from Lappeenranta University of Technology (video tape presentation) spoke about the connection between multiple-valued algebras and fuzzy logic, and studied the structures of truth value sets in more than 30 different logical systems (turunen@hauli.lut.fi). After the presentations we had a discussion on current questions of national and international fuzzy life, i.e. on synergetic effects between university research and industrial developments in Finland. The participants agreed that the future FiF seminars should continue to emphasize on relavant topics, and include representatives from other Northern European countries as well. The proceedings of FiF'93 is being published by Abo Akademi University (for copies please send an e-mail to Patrik Eklund). In the end of the workshop Patrik Eklund announced the forthcoming International MEPP'93 Seminar to be held in Marienhamn between June 14 and 18, 1993. The workshop was very successful and will be organized again on the sea between Finland and Sweden. Welcome to join the FiF'94! From wsi@altair Mon Jan 18 11:23:17 1993 Date: Mon, 18 Jan 93 11:22:39 +0100 From: wsi@altair (Wolfgang Slany) Subject: fuzzy-mail service resumes: PLEASE READ For all of you who changed your mail acknowledge status after December 18, 1992, please change it once more since all information about it is lost. Due to unlucky circumstances, the European fuzzy-mail list was destroyed last Tuesday: a hard-disk broke completely, and the last backup of the list's directory dated from December 18, 1992, due to a recent change in our backup strategy here, of which I was not informed. The system's status has now been reconstructed as far as possible up to last Monday with the help of Hideyuki Takagi, Robert Fuller, Gilles Trouessin and Andreas Geyer-Schulz. I restarted the list this morning, and all messages sent to the list and the listserver during last week's interruption should have been sent out now. In the mean time, I have worked out a backup mechanism that should work fine from now on. To my deepest regret, all persons who subscribed between Monday 11, 1993 after 16:00 MET and Tuesday 12, 1993 before 15:30 MET (times are approximate) are unknown: they either got a message that they are succesfully subscribed or that listserv is unknown at vexpert.dbai.tuwien.ac.at, but their names and email addresses are not reconstructable. If you happen to know such persons, please ask them to kindly resubscribe. Please accept my apologies for all inconvenience resulting in the interruption and loss of data. Best Regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 From gonzalez@robinson.ugr.es Mon Jan 18 17:06:23 1993 Relayed; Mon, 18 Jan 1993 17:05:28 +0100 Mon, 18 Jan 1993 14:13:22 +0100 Mon, 18 Jan 1993 14:12:41 +0100 Mon, 18 Jan 1993 14:14:07 +0100 Date: Mon, 18 Jan 1993 13:15:42 +0100 From: gonzalez@robinson.ugr.es Subject: Re: fuzzy-mail >X-Envelope-to: fuzzy-mail@vexpert.dbai.tuwien.ac.at recipients fuzzy-mail From poelzleitner@pbox.joanneum.ac.at Mon Jan 18 19:18:26 1993 Date: Mon, 18 Jan 93 19:18:09 GMT Mon, 18 Jan 93 19:18:08 +0000 Posted: Mon, 18 Jan 93 19:14:15 +0000 From: "POELZLEITNER" App-Message-Id: <3415141918011993/A04535/PRZJ00/117194CE0C00> Subject: Please forward this announcement to all subscribers Dear Collegue: Enclosed is the Call for Papers for the WORKSHOP on IMAGE ANALYSIS and SYNTHESIS that might be of interest for you (there will be special sessions on fuzzy logic and neural networks). With best regards, Wolfgang Polzleitner (JOANNEUM RESEARCH) --------------------------------------------------------------------- 17th OAGM Workshop and 4th International Workshop for Digital Image Processing and Computer Graphics Image Analysis and Synthesis June 2nd - 4th, 1993 Graz, Austria First Announcement and Call for Papers ______________________________________ The Austrian Association for Pattern Recognition (VAGM, which is part of the IAPR) in cooperation with the Austrian Academy of Sciences, the Russian Academy of Sciences, and JOANNEUM RESEARCH invite you to participate in the 3 day Workshop on Digital Image Analysis and Synthesis. Papers devoted to new trends in image analysis and synthesis, including theory, algorithms, and applications are especially welcome. Topics of interest include, but are not limited to, the following: * image processing and analysis * perception engineering * pattern recognition * computer vision * parallel and hierarchical algorithms and architectures * neural networks * remote sensing * medical and biological applications * industrial applications * fuzzy logic theory and applications * active vision General Information Registration for the workshop will take place from June 2nd, 8:30 throughout the workshop to June 4th, 1993. All papers must be received by February 15th, 1993, and application cards for participation and hotel accommodation must be received by May 1st, 1993. The working language of the workshop will be English. Invited Speakers The invited speakers will be * Professor Bruce Batchelor, of the University of Wales, College of Cardiff * Victor Soyfer, of the Institute for Aviation, Samara, Russia Submission of Papers Authors wishing to present a paper should submit a draft version and a 1000 words abstract (for the book of abstracts) by February 15th, 1993. All papers must be submitted in English. Camera-ready-copies according to the VAGM style will be requested after the workshop. Proceedings will be prepared directly by offset printing from authors' manuscripts with no additional editorial processing or retyping. A brochure of abstracts will be provided together with the conference material. The proceedings including all presented papers will be published after the conference. The papers submitted will be reviewed by the programme committee, and the authors will receive a notification of acceptance of their papers. Invitation cards with a final programme and information about location and registration will be sent to the participants. Participation Fee There will be a small participation fee which covers participation in all conference and workshop events, including the social programme and refreshments. Hotel accomodation and meals will be paid for by the participants at their own expense. Special Sessions Several special sessions will be organised around specific topics. So far the following sessions are planned: * industrial applications of image analysis and synthesis methods including system integration and tools * remote sensing, space applications and robotics * an international contact forum * image analysis tools * Mathematica-like image analysis tools To facilitate the comparison of new image analysis algorithms, this special session is devoted to the presentation of implementations in Mathematica, Maple, Matlab, etc. Prospective authors are requested to include suitable input, output data, as well as the source code, as appendices to their algorithm descriptions. This new form of presentation at a workshop should help researchers to speed up the comparison of results, reduce duplication of efforts, as well as provide learning tools for students. International Contact Forum Colleagues from neighbouring countries are invited to present the research activities of their own countries. This forum should establish international contact and facilitate the exchange of ideas. OAGM Prize All presented contributions (including the oral presentation) will be reviewed by the prize committee and the authors of the best paper will be selected to receive the VAGM best-paper award. The schedule will be: 15th February Last day of receipt of papers 1st April 1993 : Notification to authors of acceptance of their papers 1st May 1993 : Participation cards, fees, and hotel reservation cards 2nd June 1993 : Registration of participants 2nd - 4th June 1993 : Conference and workshops 30th August 1993: Publication of proceedings All correspondence should be sent to: Martin Povoden JOANNEUM RESEARCH Wastiangasse 6 A-8010 Graz Austria Tel.: (+43 316) 8020-752 Fax: (+43 316) 8020-720 e-mail: povoden@joanneum.ada.at or e-mail: poelzleitner@joanneum.ada.at Chairman: W. Polzleitner (A) Co-Chairs: B. Batchelor (UK), V. Soyfer (GUS), H. Wechsler (USA), E. Wenger (A) Organizing Committee: M. Povoden (A), A. Prohammer (A) Program Committee: I. Bajla (Slovakian Academy of Sciences, Bratislava, CSFR) W. Burger (Univ. of California at Riverside, USA) H. Feichtinger (University of Vienna, A) C. Ferm|ller (Univ. of Maryland, USA) I. Holldnder (Austrian Academy of Sciences, A) V. Karnaukhov (Russian Academy of Sciences, Moscow, GUS) W. Kropatsch (University of Technology of Vienna, A) K. Mayer (Vsterreichisches Forschungszentrum Seibersdorf, A) N. Merzliakov (Russian Academy of Sciences, Moscow, GUS) A. Muir (Scottish Centre for Agricultural Eng., Univ. of Edinburgh, UK) G. Paar (JOANNEUM RESEARCH, Graz, A) A. Pinz (University of Technology, Vienna, A) G. Shubinsky (North Western University, Chicago, USA) D. Strobl (JOANNEUM RESEARCH, Graz, A) G. Schwingshakl (JOANNEUM RESEARCH, Graz, A) E. Wenger (Austrian Academy of Sciences, Vienna, A) L. Yaroslavsky (National Institute of Health, Bethesda, USA) APPLICATION FORM I am interested in the workshop * I have not yet decided to participate ________ * I intend to participate ________ * I intend to present a paper Tentative title: ________________________________________________ * Please inform my colleague Name, Address: ________________________________________________ * Please send me further information about the workshop My e-mail address: ________________________________________________ Send to: Martin Povoden, JOANNEUM RESEARCH, Wastiangasse 6, A-8010 Graz, Austria Tel.: (+43 316) 8020-752 Fax: (+43 316) 8020-720 e-mail: povoden@joanneum.ada.at or e-mail: poelzleitner@joanneum.ada.at From wsi@altair Mon Jan 18 19:25:39 1993 Date: Mon, 18 Jan 93 19:25:00 +0100 From: wsi@altair (Wolfgang Slany) NAFIPS-L@GSUVM1.BITNET, fuzzy-jp@prec.osaka-u.ac.jp, ai-medicine@vuse.vanderbilt.edu, ca@think.com, clp.x@xerox.com, ga-list@aic.nrl.navy.mil, linguist@tamvm1.tamu.edu, nl-kr@cs.rochester.edu, qphysics@cs.washington.edu, simulation@ufl.edu Subject: UPDATE: FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 The deadline for submissions of papers and proposals of workshops for the FLAI'93 conference is January 22, 1993. Email submissions are allowed. For details regarding all aspects of the conference send E-mail to flai93_info@vexpert.dbai.tuwien.ac.at Best regards, and see you in Linz at FLAI'93, Wolfgang SLANY FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Ms. Heidi MILOS at +43-1-5055304 From finin@cs.umbc.edu Mon Jan 18 21:21:23 1993 (5.65c/IDA-1.4.4 for fuzzy-mail@vexpert.dbai.tuwien.ac.at); Mon, 18 Jan 1993 15:21:14 -0500 Date: Mon, 18 Jan 1993 15:21:14 -0500 From: Timothy Finin Subject: IEEE CAIA-93 Advance Program & Registration Information The advance program and registration information for CAIA-93 (the 9th IEEE Conference on Artificial Intelligence for Applications) is now available. The conference will be held March 1-5, 1993 at the Disney Yacht Club & Beach Club Resort Hotel in Orlando, Florida, USA. To get the advance program and registration information by email, send a message to CAIA@CS.UMBC.EDU. For additional information, contact: CAIA'93 Registration, IEEE Computer Society, 1730 Mass. Ave., N.W., Washington, DC 20036-1992 Voice:202-371-1013; Fax:202-728-0884, email:M.KABZA@COMPMAIL.COM. From takagi@diva.Berkeley.EDU Wed Jan 20 05:49:59 1993 Date: Tue, 19 Jan 93 20:49:55 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: ICNN'93 and FUZZ-IEEE'93 ===================================================================== Date: Tue, 19 Jan 93 15:52:58 PST From: Hamid Berenji Subject: IEEE Conferences ** CALL FOR PARTICIPATION ** 1993 IEEE INTERNATIONAL CONFERENCE ON NEURAL NETWORKS SECOND IEEE INTERNATIONAL CONFERENCE ON FUZZY SYSTEMS March 28 - April 1, 1993 San Francisco Hilton San Francisco, California The IEEE Neural Networks Council cordially invites you to attend the Second International Conference on Fuzzy Systems (FUZZ-IEEE'93) and the 1993 IEEE International Conference on Neural Networks (ICNN'93), to be held concurrently at the San Francisco Hilton Hotel, San Francisco, California from March 28 to April 1, 1993. These IEEE-sponsored events have grown to become the largest conferences in their fields. In 1993, their importance will be enhanced by their combined meeting in an environment that assures that conference participants will have full access to all functions and events of either of these multidisciplinary meetings. In addition to an exciting program of plenary lectures, tutorial presentations, and technical sessions and panels, we anticipate an extraordinary trade show and exhibits program affording a unique opportunity to become acquainted with the latest developments in products based on neural-networks and fuzzy-systems techniques. PLENARY SPEAKERS Lotfi A. Zadeh University of California, Berkeley Didier Dubois Universite Paul Sabatier, Toulouse Hamid R. Berenji NASA Ames Research Center Michio Sugeno Tokyo Institute of Technology E.H. Mamdani Queens Mary College, London Henri Prade Universite Paul Sabatier, Toulouse Bernard Widrow Stanford University Kumpati Narendra Yale University Teuvo Kohonen Helsinki University of Technology, Finland Richard Sutton GTE Laboratories Carver Mead California Institute of Technology Piero Bonissone General Electric Corporate R&D TUTORIALS SUNDAY MARCH 28, 1993, 9:00AM - 12:30PM 1. Introduction to Fuzzy Set Theory, Uncertainty and Information Theory George Klir State University of New York 2. Fuzzy Logic in Databases and Information Retrieval Maria Zemankova National Science Foundation 3. Fuzzy Logic and Neural Networks Pattern Recognition James Bezdek University of West Florida 4. Evolutionary Programming David Fogel Orincon Corporation 5. Introduction to Biological and Artificial Neural Networks Steven Rogers Air Force Institute of Technology 6. The Biological Brain: Biological Neural Networks Terrence J. Sejnowski The Salk Institute SUNDAY, MARCH 28, 1993, 2:00PM - 5:30PM 7. Hardware Approaches to Fuzzy Logic Applications H. Watanabe University of North Carolina 8. Fuzzy Logic and Neural Networks for Control Systems Hamid R. Berenji NASA Ames Research Center 9. Fuzzy Logic and Neural Networks for Computer Vision James Keller University of Missouri 10. Genetic Algorithms and Neural Networks Darrell Whitley Colorado State University 11. Suggestions from Cognitive Science for Neural Network Applications James A. Anderson Brown University 12. Expert Systems and Neural Networks George Lendaris Portland State University **************************************************************************** 1993 IEEE INTERNATIONAL CONFERENCE ON NEURAL NETWORKS Sponsored by the IEEE Neural Networks Council with the cooperation of the European Neural Networks Society and the Japan Neural Networks Society. IEEE Neural Networks Council Constituent Societies: IEEE Circuits and Systems Society IEEE Communications Society IEEE Computer Society IEEE Control Systems Society IEEE Engineering in Medicine & Biology Society IEEE Industrial Electronics Society IEEE Industry Applications Society IEEE Information Theory Society IEEE Lasers and Electro-Optics Society IEEE Oceanic Engineering Society IEEE Power Engineering Society IEEE Robotics and Automation Society IEEE Signal Processing Society IEEE Social Implications of Technology Society IEEE Systems, Man, and Cybernetics Society IEEE Computer Society IEEE Power Engineering Society ORGANIZATION General Chair: Enrique H. Ruspini Program Cochairs: Hamid R. Berenji Elie Sanchez Shiro Usui ADVISORY BOARD: S.I. Amari L. Cooper F. Fukushima C. Lau L. Stark J. Anderson R.C. Eberhart R. Hecht-Nielsen C.Mead A. Stubberud G. Bekey R. Eckmiller J. Holland N.Packard H. Takagi J.C. Bezdek J. Feldman C. Jorgensen D.Rummelhart P. Treleaven Y. Burnod M. Feldman T. Kohonen B. Skyrms B. Widrow ORGANIZING COMMITTEE PUBLICITY: H.R. Berenji TUTORIALS: J.C. Bezdek PRESS/PUBLIC RELATIONS: C. Welch EXHIBITS: W. Xu FINANCE: R. Tong VIDEO PROCEEDINGS: A. Bergman VOLUNTEERS: A. Worth **************************************************************************** SECOND IEEE INTERNATIONAL CONFERENCE ON FUZZY SYSTEMS Sponsored by the IEEE Neural Networks Council in Cooperation with IEEE Circuits and Systems Society IEEE Communications Society IEEE Control Systems Society IEEE Systems, Man, and Cybernetics Society International Fuzzy Systems Association (IFSA) North American Fuzzy Information Processing Society (NAFIPS) Japan Society for Fuzzy Theory and Systems (SOFT) European Laboratory for Intelligent Techniques Engineering (ELITE) ORGANIZATION General Chairman: Enrique H. Ruspini SRI International Program Chairman: Piero P. Bonissone General Electric Corporate Research and Development ADVISORY BOARD: J. Bezdek H. Prade M. Sugeno T. Yamakawa D. Dubois E. Sanchez T. Terano L.A. Zadeh G. Klir Ph. Smets E. Trillas H.J. Zimmerman ORGANIZING COMMITTEE EXHIBITS: W. Xu, A. Ralescu, M. Togai, L. Valverde, T. Yamakawa FINANCE: R. Tong(Chair), R. Nutter PRESS/PUBLIC RELATIONS: C. Welch PUBLICITY: H. Berenji (Chair),B. D'Ambrosio, R. Lopez de Mantaras, T. Takagi TUTORIALS: J. Bezdek (Chair), H.R. Berenji, H. Watanabe VIDEO PROCEEDINGS: A. Bergman VOLUNTEERS: A. Worth ************************************************************************** CONFERENCE REGISTRATION FEES: Full Conference registration permits attendance at all events and functions of both conferences with the exception of optional tour programs. The registration fee also includes one set of Proceedings (to be chosen by the registrant) for either FUZZ-IEEE '93 or ICNN '93. Additional ICNN '93 or FUZZ-IEEE '93 Proceedings or CD-ROM versions of the Proceedings are also available for purchase. Registered Registered before 1/31/93 after 1/31/93 IEEE Members $325 US Dollars $395 US Dollars Non-Members $425 US Dollars $495 US Dollars Students* $80 US Dollars $100 US Dollars TUTORIAL REGISTRATION FEES: Members Non-members Students* One Tutorial $295 $345 $150 Two Tutorials $395 $450 $200 * A letter from the Department Head to verify full-time student status at the time of registration is required. At the conference, all students must present a current student ID with picture. FOREIGN PAYMENTS MUST BE MADE BY DRAFT ON A U.S. BANK IN U.S. DOLLARS REFUND POLICY: If your registration must be canceled, your fee will be refunded less $50 U.S. dollars administrative costs. You must notify us in writing by March 1, 1993. No refunds can be given after this date. LOCATION AND ACCOMMODATIONS The Conferences will be held at the San Francisco Hilton located downtown just one block from famous Union Square in the heart of San Francisco; and just twenty minutes from San Francisco International Airport. The Hilton offers participants of the Conferences a very special room rate of $117 (Single) and $127 (Double). San Francisco Hilton One Hilton Square 333 O'Farrell Street San Francisco, CA 94102-2189 Reservations (415) 771-1400 To guarantee your reservation, you must make your reservation with payment directly to the hotel to cover the first night's stay by check or credit card. DEADLINE FOR HOTEL RESERVATIONS: March 1, 1993 SIGHTSEEING TOURS Various sightseeing tours in and around San Francisco and a Dinner Cruise will be offered. Details regarding tours as well as reservation forms will be sent upon registration for the Symposium. AIRLINE INFORMATION American Airlines has waived many of the restrictions to allow the FUZZ-IEEE '93/ICNN '93 attendees to obtain SuperSaver fares for which they would normally not qualify. Bristol Travel has been named the official travel agency for the FUZZ-IEEE '93/ICNN '93 Conferences and can assist you with all your travel needs. To make your reservations call Bristol Travel at (800) 762- 2746. Bristol Travel also provides 24-hour around the-clock service. During off hours you can call (800) 237-7980 and refer to VIT (Very Important Traveler) Number SY2CO. ************************************************************************ CONFERENCE INFORMATION AND REGISTRATION: PLEASE CONTACT: FUZZ-IEEE '93/ICNN '93 Conference Office: P.O. Box 16502 Irvine, CA 92713-6502 USA For Express Mail only: Conference Office 2603 Main Street, Suite 690 Irvine, CA 92714 USA Tel (619) 453-6222 or (800) 321-6338 FAX (714) 752-7444 E-Mail: 70750.345@compuserve.com From smc@robinson.ugr.es Wed Jan 20 12:35:58 1993 Relayed; Wed, 20 Jan 1993 12:35:50 +0100 Wed, 20 Jan 1993 12:35:17 +0100 Wed, 20 Jan 1993 12:34:40 +0100 Wed, 20 Jan 1993 12:34:24 +0100 Date: Wed, 20 Jan 1993 11:56:59 +0100 From: smc@robinson.ugr.es Subject: ECSQARU'93 Call for Papers >X-Envelope-to: fuzzy-mail@vexpert.dbai.tuwien.ac.at Dear Colleage, Enclosed you may find the Call for Papers of ECSQARU'93 Conference (two versions: ASCII and Latex). Please distribute it over the e-mail network and do not hesitase to contact us should you require supplementary information concerning ECSQARU'93. Thank you for your cooperation. %%%%%%%%%%%%%%%%%%%%%%%%%%%Call For Papers%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% ECSQARU'93 European Conference on Symbolic and Quantitative Approaches to Reasoning and Uncertainty 8-9-10 November 1993 Granada - Spain Organized by: DRUMS 2 Defeasible Reasoning and Uncertainty Management Systems, Esprit III BRA 6156 ESAPRA European Society for Automated Practical Reasoning and Argumentation With the Collaboration of: DECSAI - Universidad de Granada %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% SUBMISSION INFORMATION Four copies of paper by April 5 1993 to: Professor M.R.B. Clarke Department of Computer Science Queen Mary and Westfield College University of London Mile End Road London E1 4NS England Fax: +44 81 980 6533 e-mail: mike@dcs.qmw.ac.uk DEADLINES April 5 1993 Submission of papers June 4 1993 Notification of accept/reject July 30 1993 Final version of paper submitted for the proceedings %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% EXECUTIVE SCIENTIFIC COMMITTEE Philippe Besnard (Univ. of Rennes, France) Rudolf Kruse (Univ. of Braunschweig, Germany) Henri Prade (Univ. Paul Sabatier, Toulouse, France) Mike Clarke (QMW, Univ. of London, England), Chairman SCIENTIFIC COMMITTEE F. Bergadano (Univ. of Torino, Italy) M.Delgado (Univ. of Granada, Spain) D.Driankov (Univ. of Linkoping, Sweden) D. Dubois (Univ. Paul Sabatier, Toulouse, France) L.Farinas del Cerro (Univ. Paul Sabatier, Toulouse, France) Ch. Froidevaux (Univ. of Paris-Sud, Orsay, France) D.M. Gabbay (Imperial College, Univ. of London, England) P. Gardenfors (Univ. of Lund, Sweden) J. Kohlas (Univ. of Fribourg, Switzerland) S. Lauritzen (Univ. of Aalborg, Denmark) R. Lopez de Mantaras (CEAB, Blanes, Spain) W. Lukasiewicz (Univ. of Warsaw, Poland) E. Mamdani (QMW, Univ. of London, England) J.-J. Meyer (Free Univ. of Amsterdam, Netherlands) S. Moral (Univ. of Granada, Spain) B. Nebel (DFKI, Saarbrucken, Germany) M. Reinfrank (Siemens AG, Munich, Germany) E. Sandewall (Univ. of Linkoping, Sweden) P. Siegel (Univ. of Marseille, France) Ph. Smets (Univ. of Brussels, Belgium) K. Sundermeyer (Daimler Benz, Berlin, Germany) Y.-H. Tan (Free Univ. of Amsterdam, Netherlands) J. Treur (Free Univ. of Amsterdam, Netherlands) D. Vermeir (Univ. of Antwerpen, Belgium) H.-J. Zimmerman (RWTH, Aachen, Germany) Organizing Committee S. Acid L.M. de Campos J.E. Cano J. Huete M.T. Lamata S. Moral, Chairman J.L. Verdegay DECSAI, Univ. of Granada, SPAIN %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% AIMS AND SCOPE The first European Conference on Symbolic and Quantitative Approaches to Uncertainty was held at Marseilles in 1991, with the initial impetus coming from an Esprit II Basic Research Action called DRUMS, which was the major EC project in this area. The first conference was a great success with around fifty papers being presented, published by Springer-Verlag in their Lecture Notes in Computer Science series. For this, the second conference, we have changed the name slightly to emphasise the fact that we are not just interested in representing uncertain information, but also in using and updating it in practical, implementable, reasoning systems. This meeting is jointly sponsored by the ESPRIT III continuation of the DRUMS project, and by the newly-formed European Society for Automated Practical Reasoning and Argumentation (ESAPRA). We are looking for papers not only in logical, mathematical theories of uncertainty, and uncertain or defeasible inference, but also in practical applications, implementations and algorithms. Papers that elucidate relationships between logical and numerical approaches, provide general frameworks for uncertain inference or show how uncertain inference can be used to solve problems such as abduction and belief revision will be of special interest. Possible approaches include non-monotonic, modal, multi- valued, dynamic and resource logics; possibility theory, probability theory and belief functions; networks, probabilistic databases and fuzzy sets. Conference presentations of submitted papers will be about 30 minutes and there will be three invited reviews of major topics. The proceedings will again be published by Springer. Extended abstracts/papers of around 2000- 4000 words should be submitted to the conference chairman (see submission information overleaf) by April 5 1993. All papers will be refereed for interest, originality and technical accuracy, and a decision given by June 4 1993. Final versions of accepted papers (maximum length 8 camera-ready pages) will be required by July 30 1993. Longer versions of the best papers will be published in a special issue of the Journal of Logic and Computation. %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% PREREGISTRATION FORM: Name: First Name: Address: Zip code: City: Country: Tel: Fax: E-mail: I am interested in attending the Conference Y --- N I am interested in submitting a paper Y --- N %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% If you are planning to attend the ECSQARU-93, please send preregistration form, as soon as possible, to: Serafin Moral Departamento de Ciencias de la Computacion Universidad de Granada 18071 - Granada - SPAIN Tel: +34.58.243198 Fax: +34.58.243317 e-mail: smc@robinson.ugr.es Details about travel, hotel accommodation, and conference fees will be given with the definitive registration form. %%%%%%%%%%%%%%%%%%%%%%%% Latex Call For Papers %%%%%%%%%%%%%%%%%%%%%%%%%%%%%% \documentstyle{article} \pagestyle{empty} \setlength{\oddsidemargin}{-2.2cm} \setlength{\topmargin}{-2.8cm} \setlength{\textheight}{20cm} \setlength{\textwidth}{35cm} \begin{document} \thispagestyle{empty} \begin{minipage}[t]{9.1cm} If you are planning to attend the ECSQARU-93, \\ please send preregistration form, \\ as soon as possible, to: \vspace{1cm} \normalsize Seraf\'{\i}n Moral Departamento de Ciencias de la Computaci\'{o}n Universidad de Granada 18071 - Granada - SPAIN \vspace{0.3cm} {\bf Tel:} +34.58.243198 {\bf Fax:} +34.58.243317 {\bf e-mail:} smc@robinson.ugr.es \vspace{2cm} Details about travel, hotel accommodation, \\ and conference fees will be given with the definitive \\ registration form. \end{minipage} \begin{minipage}[t]{0.5cm} \end{minipage} \begin{minipage}[t]{9cm} \Large {\bf Submission Information} \normalsize \vspace{0.3cm} Four copies of paper by April 5 1993 to: \vspace{0.3cm} Professor M.R.B. Clarke Department of Computer Science Queen Mary and Westfield College University of London Mile End Road London E1 4NS England \vspace{0.3cm} {\bf Fax:} +44 81 980 6533 {\bf e-mail:} mike@dcs.qmw.ac.uk \Large \vspace{1cm} {\bf DEADLINES} \normalsize \begin{list}{}{\setlength{\labelwidth}{2.3cm}\setlength{\leftmargin}{2.4cm}} \item[\bf April 5 1993] Submission of papers \item[\bf June 4 1993] Notification of accept/reject \item[\bf July 30 1993] Final version of paper submitted \\ for the proceedings \end{list} \end{minipage} \begin{minipage}[t]{0.5cm} \mbox{~} \end{minipage} \begin{minipage}[t]{9.1cm} \begin{center} {\bf \vspace{0.4cm} \Huge {\it Call for Papers} \Huge \vspace{0.4cm} {\bf ECSQARU-93} \vspace{0.5cm} \huge European Conference on Symbolic and Quantitative Approaches to Reasoning and \vspace{0.2cm} Uncertainty} \vspace{0.5cm} \Large {\bf 8-9-10 November 1993} {\bf Granada - Spain} \vspace{0.6cm} \framebox{ \begin{minipage}[t]{8cm} \begin{center} {\bf Organized by:} \vspace{0.3cm} \large DRUMS 2 Defeasible Reasoning and Uncertainty Management Systems, Esprit III BRA 6156 \vspace{0.3cm} ESAPRA European Society for Automated Practical Reasoning and Argumentation \end{center} \end{minipage} } \vspace{1cm} {\bf \Large With the Collaboration of:} \large \vspace{0.3cm} DECSAI - Universidad de Granada \end{center} \end{minipage} \begin{minipage}[t]{9.4cm} \Large \noindent {\bf Executive Scientific Committee} \vspace{0.3cm} \normalsize \noindent Philippe Besnard {\small (Univ. of Rennes, France)} \noindent Rudolf Kruse {\small (Univ. of Braunschweig, Germany)} \noindent Henri Prade {\small (Univ. Paul Sabatier, Toulouse, France)} \noindent Mike Clarke {\small (QMW, Univ. of London, England)}, Chairman \vspace{0.5cm} \Large \noindent {\bf Scientific Committee} \vspace{0.3cm} \normalsize \noindent F. Bergadano {\small (Univ. of Torino, Italy)} \noindent M.Delgado {\small (Univ. of Granada, Spain)} \noindent D.Driankov {\small (Univ. of Linkoping, Sweden)} \noindent D. Dubois {\small (Univ. Paul Sabatier, Toulouse, France)} \noindent L.Farinas del Cerro {\small (Univ. Paul Sabatier, Toulouse, France)} \noindent Ch. Froidevaux {\small (Univ. of Paris-Sud, Orsay, France)} \noindent D.M. Gabbay {\small (Imperial College, Univ. of London, England)} \noindent P. Gardenfors {\small (Univ. of Lund, Sweden)} \noindent J. Kohlas {\small (Univ. of Fribourg, Switzerland)} \noindent S. Lauritzen {\small (Univ. of Aalborg, Denmark)} \noindent R. Lopez de Mantaras {\small (CEAB, Blanes, Spain)} \noindent W. Lukasiewicz {\small (Univ. of Warsaw, Poland)} \noindent E. Mamdani {\small (QMW, Univ. of London, England)} \noindent J.-J. Meyer {\small (Free Univ. of Amsterdam, Netherlands)} \noindent S. Moral {\small (Univ. of Granada, Spain)} \noindent B. Nebel {\small (DFKI, Saarbrucken, Germany)} \noindent M. Reinfrank {\small (Siemens AG, Munich, Germany)} \noindent E. Sandewall {\small (Univ. of Linkoping, Sweden)} \noindent P. Siegel {\small (Univ. of Marseille, France)} \noindent Ph. Smets {\small (Univ. of Brussels, Belgium)} \noindent K. Sundermeyer {\small (Daimler Benz, Berlin, Germany)} \noindent Y.-H. Tan {\small (Free Univ. of Amsterdam, Netherlands)} \noindent J. Treur {\small (Free Univ. of Amsterdam, Netherlands)} \noindent D. Vermeir {\small (Univ. of Antwerpen, Belgium)} \noindent H.-J. Zimmerman {\small (RWTH, Aachen, Germany)} \vspace{0.7cm} {\bf Organizing Committee} \vspace{0.3cm} \begin{minipage}[t]{3cm} S. Acid L.M. de Campos J.E. Cano J. Huete \end{minipage} \begin{minipage}[t]{1cm} \end{minipage} \begin{minipage}[t]{3cm} M.T. Lamata S. Moral, Chairman J.L. Verdegay \end{minipage} \vspace{0.2cm} DECSAI, Univ. of Granada, SPAIN \end{minipage} \begin{minipage}[t]{0.3cm} \end{minipage} \begin{minipage}[t]{8.8cm} \Large {\bf AIMS AND SCOPE} \vspace{0.5cm} \normalsize The first European Conference on Symbolic and Quantitative Approaches to Uncertainty was held at Marseilles in 1991, with the initial impetus coming from an Esprit II Basic Research Action called DRUMS, which was the major EC project in this area. The first conference was a great success with around fifty papers being presented, published by Springer-Verlag in their Lecture Notes in Computer Science series. For this, the second conference, we have changed the name slightly to emphasise the fact that we are not just interested in representing uncertain information, but also in using and updating it in practical, implementable, reasoning systems. This meeting is jointly sponsored by the ESPRIT III continuation of the DRUMS project, and by the newly-formed European Society for Automated Practical Reasoning and Argumentation (ESAPRA). We are looking for papers not only in logical, mathematical theories of uncertainty, and uncertain or defeasible inference, but also in practical applications, implementations and algorithms. Papers that elucidate relationships between logical and numerical approaches, provide general frameworks for uncertain inference or show how uncertain inference can be used to solve problems such as abduction and belief revision will be of special interest. Possible approaches include non-monotonic, modal, multi- valued, dynamic and resource logics; possibility theory, probability theory and belief functions; networks, probabilistic databases and fuzzy sets. Conference presentations of submitted papers will be about 30 minutes and there will be three invited reviews of major topics. The proceedings will again be published by Springer. Extended abstracts/papers of around 2000- 4000 words should be submitted to the conference chairman (see submission information overleaf) by April 5 1993. All papers will be refereed for interest, originality and technical accuracy, and a decision given by June 4 1993. Final versions of accepted papers (maximum length 8 camera-ready pages) will be required by July 30 1993. Longer versions of the best papers will be published in a special issue of the Journal of Logic and Computation. \end{minipage} \begin{minipage}[t]{0.7cm} \mbox{~~~} \end{minipage} \begin{minipage}[t]{8.5cm} \Large {\bf Preregistration Form:} \normalsize \vspace{1cm} \vspace{0.2cm} {\bf Name:} \vspace{0.2cm} {\bf First Name:} \vspace{0.2cm} {\bf Address:} \vspace{2cm} {\bf Zip code:}\hspace{3cm} {\bf City:} \vspace{0.2cm} {\bf Country:} \vspace{0.3cm} {\bf Tel:} \vspace{0.2cm} {\bf Fax:} \vspace{0.2cm} {\bf E-mail:} \vspace{2cm} \framebox[4mm]{} I am interested in attending the Conference \vspace{0.2cm} \framebox[4mm]{} I am interested in submitting a paper \end{minipage} \end{document} From Keresztfalvi@wiwi.uni-frankfurt.dbp.de Thu Jan 21 16:00:03 1993 Relayed; Thu, 21 Jan 1993 15:59:57 +0100 Thu, 21 Jan 1993 15:59:29 +0100 Thu, 21 Jan 1993 15:59:09 +0100 Thu, 21 Jan 1993 15:58:02 +0100 Thu, 21 Jan 1993 15:58:44 +0100 Thu, 21 Jan 1993 15:58:45 +0100 Date: Thu, 21 Jan 1993 15:58:45 +0100 From: Tibor Keresztfalvi help From liuy@murmur.fiu.edu Thu Jan 21 19:27:44 1993 Date: Thu, 21 Jan 93 13:27:40 EST From: liuy@murmur.fiu.edu (Yao-Sheng Liu) To who it may concern: I am a sudent at FLORIDA INTERNATIONAL UNIVERSITY. I am beginning to do research and developement about fuzzy logic application in Artificial Intelligence field. If possible, could you mail or send some information(paper or PostScript versions) to me ? I appreciate that. My mailing address is: 7436 SW 56 Ave Apt #1 Miami, FL 33143 U. S. A. Yao-Sung Liu From til.com!tanaka@til.com Thu Jan 21 22:56:14 1993 Date: Thu, 21 Jan 93 13:49:21 PST From: tanaka@til.com (Yokichi Tanaka) Subject: Re: Looks like you have e-mail access. Then, that means you can use our fuzzy mail server. To do so, send an e-mail message like the following path liuy@murmur.fiu.edu help list to: fuzzy-server@til.com It will give you a listing of all that's available on our e-mail fuzzy server. Yoke Let me know if you have any difficulties. -- Yoke Tanaka Togai InfraLogic, Inc. "fuzzy" tanaka@til.com 5 Vanderbilt, Irvine, Calif 92718, USA gordius!til!tanaka 714-975-8522 From cruz@ctima.uma.es Fri Jan 22 08:09:47 1993 Relayed; Fri, 22 Jan 1993 08:09:46 +0100 Fri, 22 Jan 1993 08:09:04 +0100 Fri, 22 Jan 1993 08:08:29 +0100 Fri, 22 Jan 1993 07:09:30 +0100 Date: Fri, 22 Jan 1993 07:09:30 +0100 Conversion: Prohibited From: JL Perez-de-la-Cruz help subscribe fuzzy-mail J.L. Perez-de-la-Cruz From zorat@cs.unitn.it Fri Jan 22 11:56:46 1993 Date: Fri, 22 Jan 1993 09:41:13 +0100 From: zorat@cs.unitn.it (Alessandro Zorat) Subject: Call for papers Dear fuzzy-mailing-list subscribers: I am sending this call for papers for the upcoming workshop CIFT '93. I hope to see you here in Trento. ------------ CALL FOR PAPERS 3-rd INTERNATIONAL WORKSHOP CIFT'93 CURRENT ISSUES IN FUZZY TECHNOLOGIES Fuzzy Control: Design, Tuning, and Applications Trento, Italy, June 3-4, 1993 Organizing and program committee Mario Fedrizzi Aldo G. Ventre University of Trento (I) University of Napoli (I) Erich P. Klement Alessandro Zorat University of Linz (A) University of Trento (I) This international workshop is the third in the series Current Issues in Fuzzy Technology. Because of the growing interest in this topic, the increasing number of participants, and the more diversified points of view, the workshop program will be more tightly structured and will focus on a specific topic, all the while maintaining the original aim to foster a constructive dialog between industry and academia. The strong interest shown by industry in the use of fuzzy technology for control purposes has suggested that this year's choice should be in the field of Fuzzy Control, focussing specifically on Design issues, on the Tuning of a fuzzy controller, and on the realization of Applications. The outline of the program is as follows: Th. June 3-rd Fri. June 4-th 8:30 - 9:00 Registration 9:00 - 10:00 Invited lecture Invited lecture 10:00 - 10:30 Coffee break Coffee break 10:30 - 11:30 Contributed papers Contributed papers 11:30 - 12:30 Round-table discussion Round-table discussion 12:30 - 14:30 Lunch Lunch 14:30 - 16:00 Contributed papers Applications 16:00 - 16:30 Coffee break Coffee break 16:30 - 18:00 Contributed papers Applications 19:30 - 21:30 Dinner The two morning sessions will be devoted to the design of the rule-base and the tuning of a fuzzy controller, respectively. They each start with an invited lecture (1 hr.) given by a leading expert in the area. In this lecture, a survey of the field is presented to provide a common framework for the contributed papers (1 hr.) following the morning break, and the concluding round-table discussion (1 hr.) The Thursday and Friday afternoon sessions will be devoted to contributed papers and real applications, respectively. Submissions of papers are invited; of particular interest will be contributions directly related to the focus of the workshop: methods to derive the rule-base by means of neural techniques, by clustering techniques, by rule interpolation, etc.; methods to improve the performance of a fuzzy controller, its stability or other parameters; measures of such improvements and so on. Papers relating recent results and work-in-progress will be also of interest for the contributed paper session of thursday afternoon. Finally, presentations and demonstrations of real applications of fuzzy control are solicited for the second afternoon session. The Thursday evening banquet will be provided by the workshop. Information for authors All authors whishing to submit a contribution should send three typed copies of an extended abstract (2-4 pages) no later than March 15, 1993. Fax and E-mail submissions (MS-Word or Latex format) are acceptable. Notifications of acceptance will be posted by April 15, 1993 Workshop secretariat c/o Prof. Alessandro Zorat Dept. of Computer and Management Science University of Trento I-38100 TRENTO - ITALY Phone: +39 (461) 88-2118 Fax: +39 (461) 88-2124 E-mail: cift93@cs.unitn.it _________________________________________________ CIFT'93 - Registration Form First Name: ..................................................... Last Name: ..................................................... Affiliation: ..................................................... Address: ........................................................ .................................................................. .................................................................. Zip code ...........Country ........................... E-mail: .......................... Phone: [.......] (.........) ................... Fax: [.......] (.........) ................... [country-code] (area-code) number Arrival date: ............................................... Departure date: ............................................... Registration Fee A registration fee for Lit. 200.000 - or US$ 150 is required from all participants. The registration fee can be paid in advance by check payable to CIFT'93, or by inter-bank fund-transfer to: Account name: CIFT'93 Account number: 5.3.50969/4 CAB: 1802 ABI: 8013 Bank address: Cassa Rurale di Aldeno, Via Verdi 19 38100 TRENTO- ITALY Cancellations: The registration fee will be refunded fully upon written request mailed before April 30, 1993. No refunds will be given for late cancellations. Please return this registration form to: CIFT'93 secretariat c/o Prof. Alessandro Zorat Dept. of Computer and Management Science University of Trento I-38100 TRENTO - ITALY E-mail: cift93@cs.unitn.it From AREK@pz-oekosys.uni-kiel.dbp.de Fri Jan 22 13:11:16 1993 Relayed; Fri, 22 Jan 1993 13:11:02 +0100 Fri, 22 Jan 1993 13:10:52 +0100 Fri, 22 Jan 1993 13:10:32 +0100 Fri, 22 Jan 1993 13:09:07 +0100 Fri, 22 Jan 1993 12:22:25 +0100 Date: Fri, 22 Jan 1993 12:22:25 +0100 From: Arek Salski Subject: CFP workshop Fuzzy Logic in Ecological Modelling Fuzzy Logic in Ecological Modelling Workshop, October 12-14,1993 Ecosystem Research Center, University of Kiel, Germany - First Announcement and Call for Papers - In many fields of ecological research ecologists have to work with both objective and subjective information. Fuzzy logic lets them combine numerical data and linguistic statements in a unified manner. A fuzzy logic approach allows to deal with some uncertainty problems in ecological research, namely uncertainty of ecological data and uncertainty of expert knowledge. The purpose of this workshop is to present and to discuss state-of-the-art applications of fuzzy logic in the field of ecology. Topics of the workshop All aspects of fuzzy logic related to ecological research, and particulary applications of fuzzy logic to: - Qualitative Modelling - Approximate Reasoning Methods - Knowledge Representation - Expert Systems - Clustering - Databases in ecology. Participation The number of participants is limited to 30. Priority will be given to participants presenting papers. The workshop participation will be free of charge. Submission of abstracts Abstracts of paper (max. 1 page) should be sent to Dr. A. Salski not later than March 31, 1993. Reports on work in progress are welcome. Proceedings The organizers anticipate the publication of reviewed papers in a special issue of "Ecological Modelling" (Elsevier) 8-12 months after the workshop. A booklet of abstracts will be available at the workshop. Important Dates Registration and submission of abstracts...........March 31, 1993 Notification of acceptance ........................April 30, 1993 Submission of papers ..............................at the workshop Contact Address: Dr. A. Salski Projektzentrum Oekosystemforschung Universitaet Kiel Schauenburgerstr. 112 D-2300 KIEL, Germany Fax: ++49-431-880 40 83 E-Mail (Internet): arek@pz-oekosys.uni-kiel.dbp.de -- arek@pz-oekosys.uni-kiel.dbp.de Projektzentrum Oekosystemforschung Schauenburger Str. 112 * D-2300 Kiel 1 From cmc37@scm.teesside.ac.uk Fri Jan 22 20:32:45 1993 Relayed; Fri, 22 Jan 1993 20:32:43 +0100 Fri, 22 Jan 1993 20:32:11 +0100 Fri, 22 Jan 1993 20:31:11 +0100 Fri, 22 Jan 1993 15:15:01 +0100 Fri, 22 Jan 1993 11:32:55 +0100 Date: Fri, 22 Jan 1993 11:32:55 +0100 From: M Kallala Lecturer Subject: Re: path liuy@murmur.fiu.edu help list From til.com!tanaka@til.com Fri Jan 22 23:59:56 1993 Date: Fri, 22 Jan 93 14:28:15 PST From: tanaka@til.com (Yokichi Tanaka) Subject: Re: > Date: Fri, 22 Jan 93 20:33:39 +0100 > From: M Kallala Lecturer > To: Multiple recipients of list > Subject: Re: > Status: R > > path liuy@murmur.fiu.edu > help > list > >From this list, it looks like you were trying to access our fuzzy-server. I will forward the request to our fuzzy-server. For your future use ... the correct address is: fuzzy-server@til.com Thank you. Yoke Tanaka tanaka@til.com Senior Engineer Togai InfraLogic, Inc. -- Yoke Tanaka Togai InfraLogic, Inc. "fuzzy" tanaka@til.com 5 Vanderbilt, Irvine, Calif 92718, USA gordius!til!tanaka 714-975-8522 From remco@cs.ruu.nl Mon Jan 25 09:30:27 1993 (5.65c/IDA-1.4.4 for fuzzy-mail@vexpert.dbai.tuwien.ac.at); Mon, 25 Jan 1993 03:30:21 -0500 From: Remco Bouckaert Subject: Date: Mon, 25 Jan 93 3:30:21 EST help From joseba@esaii.upc.es Wed Jan 27 10:21:23 1993 Relayed; Wed, 27 Jan 1993 10:19:16 +0100 Wed, 27 Jan 1993 10:18:58 +0100 Wed, 27 Jan 1993 10:18:26 +0100 Wed, 27 Jan 1993 10:17:29 +0100 Date: Wed, 27 Jan 1993 10:17:29 +0100 Conversion: Prohibited From: Joseba Quevedo ================== CALL FOR PAPERS EUROPEAN WORKSHOP : IFCA Industrial Fuzzy Control and Applications Dates : 21 - 22 - 23 April 1993 Location : Escola Tecnica Superior d'Enginyers Industrials de Terrassa (Barcelona) Spain ORGANIZING INSTITUTIONS SAC (Sistemes Avancats de Control) Dept. ESAII, Universitat Politecnica de Catalunya CERCA, Col.lectiu d'Estudis i Recerca en Control i Automatica, Universitat Politecnica de Catalunya Asociacion Espanyola de Tecnologias y Logica Fuzzy SPONSORED BY Universitat Politecnica de Catalunya GR "Automatique, Pole ASAI, C.N.R.S. L.A.A.S.- C.N.R.S. Toulouse Excm. Ajuntament de Terrassa Diputacio de Barcelona Generalitat de Catalunya DGICYT, Ministerio de Educacion y Ciencia Purpose of IFCA WORKSHOP The joint organization of IFCA by an university research group, a technical collective and a national society is motivated by the present success of Fuzzy Logic contribution to regulation and control techniques. Although several meetings on this topic are beeing held nowadays, IFCA pretends to enhance the practical applications and the evaluation of their performances with reference to other classical or advanced control techniques. SAC is a research line of the ESAII (Systems Engineering, Control, and Industrial Informatics) department of Polytechnic University of Catalonia. The group main activity is to join advanced theoretical results to practical industrial problems in regulation and control. The performance analysis of fuzzy control is one of the new interests of this group, mostly by comparison with other advanced control techniques CERCA is a local associations gathering essentially scientists and engineers on Automation and Control as well industrial as academic, mainly from the catalan universities.Updated technicalinformation is discussed in its regular meetings and specific projects are followed so that many publications in national and international conferences or journals have been successfully signed by the collective. The Asociacion Espanyola de Tecnologias y Logica Fuzzy has been recently created with the aim to gather the potentialities of academic and industrial institutions dealingwith Fuzzy Logic and Fuzzy technologies in whatever of their activities. It will cooperate in the organization of workshops, seminars, courses as well as in the diffusion of scientific publications. TOPICS COVERED : Papers are being sollicited for presentation at the workshop and for publication in the pre-prints: topics of interest include essentially description of innovative applications of fuzzy control in industrial environments, and proposed of tools for design and implementation of fuzzy or related controllers. Papers describing comparison of performances of fuzzy with other types of controllers are welcome, even if this comparison is unfavourable to the formers. The technical program will include :1 keynote adress, 5 plenary conferences, about 30 regular papers and 4 or 5 product demos. INTERNATIONAL SCIENTIFIC COMMITTEE Chairman : Jose-Luis VERDEGAY (Universidad de Granada) president of the Asociacion Espanyola de Tecnologias y Logica Fuzzy Members : Bernadette BOUCHON-MEUNIER (Universite de Paris VI) Mieczyslav BRDYS (University of Birmingham) Francois CELLIER (University of Arizona-Tucson) Ma-Teresa DE PEDRO (CSIC-IAI, Madrid) Didier DUBOIS (IRIT- Universite Paul Sabatier, Toulouse) Francesc ESTEVA (CSIC-Centre destudis Avancats de Blanes) Laurent FOULLOY (LAMII, Universite de Savoie, Annecy) Christian FREKSA (Hamburg Universit Alfonso GARCIA CEREZO (Universidad de Malaga) Ricardo GARCIA ROSA (CSIC-IAI, Madrid) Julio GUTIERREZ RIOS (INTA- UP de Madrid) Ramon LOPEZ de MANTARAS (CSIC-IIIA, Blanes) Roger MARTIN-CLOUAIRE (INRA- Toulouse) Claudio MORAGA (University of Dortmund) Anibal OLLERO (Universidad de Malaga) Teresa RIERA (Universitat de les Illes Balears) Tomas SALOKI (Tech. Univ. Kosice, Presov) Andre TITLI ( MIRGAS-LAAS-CNRS, Toulouse) Settimo TERMINI (Universita di Palermo) Enric TRILLAS (INTA- UP de Madrid) Llorenc VALVERDE (Universitat de les Illes Balears) Amparo VILA (Universidad de Granada) Jaroslav VOLCIK ( Technical University , Praha) Didier WILLAEYS (Universite de Valenciennes) Lotfi ZADEH (University of California-Berkeley LOCAL SCIENTIFIC COMMITTEE Chairman: Joseph AGUILAR MARTIN, (ESAII-UPC Terrassa & LAAS CNRS Toulouse) Members : Rosa ARGELAGUET, (Dept. EE-EUP-UPC Manresa) Francesc ASTALS, (Subdirector, ETSEIT-UPC Terrassa ) Gabriela CEMBRANO (Inst. Cib.-UPC-CSICBarcelona) Teresa ESCOBET (Dept.EMRN-EUP-UPC Manresa) Josep-Maria FUERTES (Dept. ESAII-FIB-UPC Barcelona) Juan A. GALLARDO (Dept. EE-EUETIT-UPC Terrassa) Lluis GODO (IIIA-CEAB-CSIC, Blanes) Montse PONS (Dept. MA3-EUP-UPC Manresa) Nuria PIERA (Dept. MA2-FIB-UPC Barcelona) Joseba QUEVEDO (Dept. ESAII-ETSEIT-UPC Terrassa) Josep VEHI (Universitat de Girona) PRACTICAL INFORMATION : Workshop participation fees: 20 000 pts, authors & students 10 000 pts. Social program (included in the participation fees): April 21 -Welcome cocktail, April 22 - Banquet. DEADLINES: please return the Submission Form as soon as possible: 15th of February 1993 : FULL PAPER ( 6 pages max. length) 15th of March 1993 : notification of acceptance SUBMISSION FORM : NAME .............................................................................................................................. Affiliation ......................................................................................................................... ADDRESS........................................................................................................................... tel:................................... fax ................................... e-mail ................................... I plan to attend the IFCA workshop .................YES/NO I intend to submit a full paper before Feb. 15 (maximum 6 pages A4, ready to print) .................YES/NO provisional title : Please send me information on hotel accomodation in Terrassa .................YES/NO PLEASE contact the IFCA SECRETARY: Joan VERT, Secretary of I.F.C.A. Grup Sistemes Avancats de Control E.T.S.E.I.T. c/. Colom n! 11 08222 TERRASSA (Spain) tel: +34 3 739 81 44, fax +34 3 739 81 01 e-mail : aguilar@esaii.upc.es From nakatsu@ea5.yz.yamagata-u.ac.jp Fri Jan 29 09:45:27 1993 From: nakatsu@ea5.yz.yamagata-u.ac.jp (Mikio Nakatsuyama) Subject: References Date: Fri, 29 Jan 93 17:44:10 +0900 Now I am interesting in fuzzy neuro expert systems. So I hope to refer to the following paper: Ollero,A;Garcia-Cerezo,A;Araci,J. Design of rule-based expert controllers, ECC91 European Control Conference, Grenoble, France, pp.578-583, 1991. I appreiate that anyone informs me how to get its copy. Dr. Mikio Nakatsuyama Department of Electronic Engineering Yamagata University 4-3-16 Jonan, Yonezawa 992 Japan Tel: +81-238-22-5181 EXT 329 Fax: +81-238-24-2752 E-mail: nakatsu@ea5.yz.yamagata-u.ac.jp From takagi@diva.Berkeley.EDU Mon Feb 1 16:52:39 1993 Date: Mon, 1 Feb 93 07:52:36 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: Workshop on FL in AI Dear members of three fuzzy mailing lists and my private list: From: anca@fuzzy.or.jp (Anca RALESCU) Date: Mon, 01 Feb 93 14:13:26 +0900 Subject: IJCAI-93 Fuzzy Logic in AI Workshop ------------ C A L L F O R P A R T I C I P A T I O N The second Workshop on FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE to be held in conjunction with IJCAI-93 Chamberry, FRANCE August 28, 1993 Fuzzy logic has become a standard approach in several areas of engineering. At the same time an important body of work is directed towards the use of fuzzy logic in the AI research. The goal of this workshop is to provide a forum for those active in the area of fuzzy logic in AI. The workshop will focus on the use of fuzzy logic (alone or in addition to other paradigms for management of uncertainty in AI) for: -knowledge representation. -representation, learning and recognition of natural/complex concepts. -approximate reasoning (syllogisms, interpolation, evidence combination). Traditionally, fuzzy logic based approaches have been successfully implemented in real working systems and/or commercial products. In this spirit contributions to the workshop describing and analyzing practical results are strongly encouraged. DEADLINES: - Extended abstracts (of up to four typed pages) or full papers of up to eight pages are due by March 1, 1993. The authors should include address, phone number, fax number and/or e-mail address. It is estimated that the talks will be limited to fifteen or twenty minutes, with an additional five minutes for discussions. - Notification of acceptance by April 1, 1993. - Revised paper/extended abstract to be received by June 1, 1993. This date is firm for inclusion in the workshop volume. REGISTRATION: The workshop registration fee is 300 French Francs (approximately 60 US. Dollars) in addition to the registration fee for the main conference (IJCAI-93). No participation to the workshop is possible without registration to the main conference. SUBMISSION OF PAPERS: Papers to be submitted to the workshop (as well as requests for information regarding this workshop) should be directed to: Anca Ralescu LIFE, Siber Hegner Building 3rd Floor 89-1 Yamashita- Cho, Naka-ku, Yokohama 231, JAPAN Tel: (81)(45)212-8239 Fax: (81)(45)212-8255 e-mail: anca@fuzzy.or.jp From zuliang@iss.nus.sg Tue Feb 2 08:20:04 1993 fuzzy-mail@vexpert.dbai.tuwien.ac.at Subject: ask help Date: Tue, 02 Feb 93 15:23:00 +0800 From: zuliang@iss.nus.sg Hi there, I wish to put an article of Prof. Zadeh in my paper but I couldn't find the orange article so that I don't know the Vol. No of the article in. Could you kindly help me on the problem? L.A.Zadeh, The birth and evolution of fuzzy logic (Based on a lecture presented on the occasion of the award of the 1989 Honda Prize), J. Japan Soc. Fuzzy Theory Syst. Vol ???(1989). --- Please help me here! Looking forward to hearing from you as soon as possible Zuliang =========================================================================== Dr. Zuliang SHEN | Tel:+65-772-6243 Institute of Systems Science | Fax:+65-778-2571 National University of Singapore | Heng Mui Keng Terrace, Kent Ridge | INTERNET: zuliang@iss.nus.sg SINGAPORE 0511 | BITNET: issszl@nusvm From takagi@diva.Berkeley.EDU Tue Feb 2 19:14:37 1993 Date: Tue, 2 Feb 93 10:14:36 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) zuliang@iss.nus.sg Subject: Re: ask help Dear Dr. Zulinang Shen: What you are looking for is : Lotfi A. Zadeh, "The Birth and Evolution of Fuzzy Logic," (Text of a lecture presented on the occasion of the award of the 1989 Honda Prize, Tokyo, Japan), Journal of Japan Society for Fuzzy Theory and Systems, Vol.2, No.1, pp.2-11 (1990). Hideyuki TAKAGI / UC Berkeley From nauck@ibr.cs.tu-bs.de Wed Feb 3 13:58:24 1993 From: nauck@ibr.cs.tu-bs.de (Detlef Nauck) Subject: Workshop Fuzzy Systems'93 in Germany Date: Wed, 3 Feb 93 13:58:03 MET ============================================================================== C A L L F O R P A P E R S W O R K S H O P F U Z Z Y S Y S T E M S '9 3 Dates: 21 - 22 October 1993 Location: Braunschweig, Germany PURPOSE OF THE WORKSHOP The first workshop on fuzzy systems by the German Society of Computer Science (GI), the German Computer Science Academy (DIA), and the University of Braunschweig is motivated by the present success of fuzzy logic. Topics of interest cover the description of innovative aspects of fuzzy control, but also interdisciplinary work on control engineering (e.g. stability analysis) and artificial intelligence (e.g. possibilistic logic, non-monotonicity, qualitative reasoning, neural networks). Related to these topics FUZZY SYSTEMS '93 intends to reach a balance between theoretical foundations and the presentation of methods, tools, and industrial applications. Workshop languages are English and German. The workshop participation fee is 430 DM. SCIENTIFIC COMMITTEE R. Kruse (chair), C. Freksa, S. Gottwald, H. Hellendoorn, K.D. Meyer-Gramann, B. Reusch, W. Wahlster, H.-J. Zimmermann INVITED SPEAKERS D. Dubois (Toulouse) A. Mamdani (London) DEADLINES April 30, 1993 : Submission of extended abstracts (3-4 pages), 4 copies by regular mail to Prof. Dr. Rudolf Kruse University of Braunschweig Dept. of Computer Science Bueltenweg 74-75 3300 Braunschweig Germany (Email: kruse@ibr.cs.tu-bs.de) May 31, 1993 : Notification of acceptance/rejection July 31, 1993 : Submission of long version of accepted papers for the proceedings TUTORIAL On October 20, 1993 there is a tutorial on fuzzy systems by R. Kruse (University of Braunschweig) and R. Palm (Siemens AG, Munich). The tutorial participation fee of 480 DM includes the new books R. Kruse, J. Gebhardt, F. Klawonn : Fuzzy-Systeme, Teubner, 1993, and D. Driankov, H. Hellendoorn, M. Reinfrank : An Introduction to Fuzzy Control, Springer, 1993. FURTHER INFORMATION Please contact Deutsche Informatik-Akademie GmbH Wissenschaftszentrum Ahrstr. 45 5300 Bonn 2 Germany Tel.: +49.228.302165 FAX : +49.228.378690 ============================================================================== From @prg.oxford.ac.uk:hje@robots.oxford.ac.uk Wed Feb 3 14:23:18 1993 Relayed; Wed, 3 Feb 1993 14:23:00 +0100 Wed, 3 Feb 1993 14:22:28 +0100 Wed, 3 Feb 1993 14:20:15 +0100 Wed, 3 Feb 1993 13:29:49 +0100 Wed, 3 Feb 1993 13:28:55 +0100 Wed, 3 Feb 1993 13:28:56 +0100 Wed, 3 Feb 1993 13:28:56 +0100 Date: Wed, 3 Feb 1993 13:28:56 +0100 From: hje@robots.oxford.ac.uk GUPTAM@sask.usask.ca, GUPTAM@sask.usask.ca, H1256Koc@huella.bitnet, I7110205 , ISSWPZ@NUSVM.BITNET, L.Rolfe@qmw.ac.uk, PEKLUND@finabo.abo.fi, RICHARD@buggi.or.rwth-aachen.de, SKAHN@Twins.GoldStar.CO.KR, SLC@risc.rockwell.com, VANGELIS@KSUVM.tuwien.ac.at, VDWALLE@BMLSCK11.tuwien.ac.at, alex@spindletop.tamu.edu, asmorton@NMSU.edu, badami@crd.ge.com, berenji@pluto.arc.nasa.gov, bonissone@crd.ge.com, c1407@trl.mei.co.jp, cclee@diva.Berkeley.EDU, chizuru@cc.u-tokai.ac.jp, eletter@ivy.Princeton.EDU, fuzzy-mail@vexpert.dbai.tuwien.ac.at, fuzzy@prec.osaka-u.ac.jp, gebhardt@gmd.de, glen@diva.berkeley.edu, guo@rhum.gmd.de, hah@smaragd.zfe.siemens.de, hall@usf.edu, hartman@pav.mcc.com, hayashi@ibaraki.ac.jp, hje@robots.oxford.ac.uk, info@til.com, jamesj , jang@diva.berkeley.edu, khedkar@janus.berkeley.edu, kogure@ams.mei.co.jp, nakatsu@ea5.yz.yamagata-u.ac.jp, neuro@it4.crl.mei.co.jp, ohara@mcc.com, ppw@dukee.egr.duke.edu, bbb@pruxg, reinfra@ztivax.siemens.com, remmele@ztivax.siemens.com, rlea@nasamail.nasa.gov, roventa@venvs.yorku.ca, styblins@edu.tamu.ee, sun@cs.berkeley.edu, swami@cssun.tamu.edu, takagi@cs.berkeley.edu, tomitaka@cvts.sony.co.jp, yamachan@lab1.fuzzy.or.jp, yen@cs.tamu.edu, zuliang@iss.nus.sg Subject: Special Issue of Fuzzy Sets and Systems on 20 years of Fuzzy Control Call For Papers Special Issue of Fuzzy Sets and Systems on Fuzzy Control 1994 will mark 20 years since the publication of the first paper on fuzzy control by Assilian and Mamdani. Since then, fuzzy control has seen many significant developments, with dedicated fuzzy control chips and working applications in industry, manufacturing, consumer products and many more. A special issue of Fuzzy Sets and Systems will mark this anniversary. Papers are solicited on the theory, applications and hardware used in fuzzy control. Papers reviewing applications in particular sectors are welcome. Prospective authors are invited to contact the editor of the special issue. All papers will be subject to the usual refereeing procedures. The special issue is planned to appear in early 1994. Authors should submit their papers by 15 September 1993 to allow adequate time for refereeing and revision. Please contact Janet Efstathiou if you would like to submit a paper for the special issue. Further information and instructions for authors may be obtained from Dr H-J Zimmermann, Editor, Fuzzy Sets and Systems, RWTH Aachen, Templergraben 64, D-5100 Aachen, 5-Obergeschoss, Germany. Janet Efstathiou Editor of Special Issue. Department of Engineering Science, Oxford University, Parks Road, Oxford OX1 3PJ UK From wsi@altair Wed Feb 3 14:31:25 1993 Date: Wed, 3 Feb 93 14:30:26 +0100 From: wsi@altair (Wolfgang Slany) Subject: ISATA Meeting, Aachen 13-17 September 1993 ----- Begin Included Message ----- >From fuzzy-jp@prec.osaka-u.ac.jp Wed Feb 3 07:55:31 1993 Date: Wed, 3 Feb 93 15:54:28 JST From: anca@fuzzy.or.jp (Anca RALESCU) Subject: ISATA Meeting, Aachen 13-17 September 1993 26th ISATA Aachen, Germany 13-17 September 1993 Fuzzy Logic Technology in the Automotive Industry The Dedicated Conference on Mechatronics of the 26th International Symposium on Automotive Technology and Automation (ISATA) Meeting to be held in Aachen, Germany during 13-17 September 1993 will have one or more sessions on fuzzy logic technology for the automotive industry. Those interested in submitting a paper for presentation in one of these sessions should do so by sending an abstract (one to four pages in length) by March 1 to: Dr. Anca Ralescu LIFE, Siber-Hegner Building 3Fl. 89-1 Yamashita-Cho, Naka-Ku Yokohama 231, Japan Tel: (+81)(45)212-8239 fax: (+81)(45)212-8255 e-mail: anca@fuzzy.or.jp Fax and electronic mail submissions are accepted. In order to minimize disruptions in the conference schedule due to "no shows" IT IS REQUESTED THAT PEOPLE SUBMITTING AN ABSTRACT FOR THE CONFERENCE SERIOUSLY CONSIDER ATTENDING THE CONFERENCE. All abstract submissions will be acknowledged. The further schedule for paper preparation is as follows: Notification of Acceptance: April 1, 1993 Final paper due date: May 31, 1993 ----- End Included Message ----- From arras@forwiss.uni-erlangen.de Wed Feb 3 14:38:39 1993 Date: Wed, 3 Feb 93 14:44:48 +0100 From: Mike Arras Subject: Re: ISATA Meeting, Aachen 13-17 September 1993 Just thought that I would pass this on. Mike > 26th ISATA > Aachen, Germany > 13-17 September 1993 > >Fuzzy Logic Technology in the Automotive Industry > >The Dedicated Conference on Mechatronics of the 26th International >Symposium on Automotive Technology and Automation (ISATA) Meeting to >be held in Aachen, Germany during 13-17 September 1993 will have one >or more sessions on fuzzy logic technology for the automotive >industry. > >Those interested in submitting a paper for presentation in one of >these sessions should do so by sending an abstract (one to four pages >in length) by March 1 to: > > Dr. Anca Ralescu >LIFE, Siber-Hegner Building 3Fl. >89-1 Yamashita-Cho, Naka-Ku >Yokohama 231, Japan > >Tel: (+81)(45)212-8239 >fax: (+81)(45)212-8255 >e-mail: anca@fuzzy.or.jp > >Fax and electronic mail submissions are accepted. > >In order to minimize disruptions in the conference schedule due to "no >shows" IT IS REQUESTED THAT PEOPLE SUBMITTING AN ABSTRACT FOR THE >CONFERENCE SERIOUSLY CONSIDER ATTENDING THE CONFERENCE. > >All abstract submissions will be acknowledged. > >The further schedule for paper preparation is as follows: > >Notification of Acceptance: April 1, 1993 >Final paper due date: May 31, 1993 From nagisetty@comet.srl.ford.com Thu Feb 4 22:10:49 1993 Date: Thu, 4 Feb 1993 16:04:52 -0500 From: nagisetty@comet.srl.ford.com Subject: Fuzzy Logic, Manufacturing, Energy Management May I ask You for references if they are known to you where Fuzzy Logic is used in a) manufacturing processes (Europe) b) energy management (in factories) (Europe) Thank You for Your effort. Best Regards, I. Nagisetty (e-mail: nagisetty@srlvx1.srl.ford.com) Ford Motor Company AMDC 24500 Glendale Ave Detroit, MI 48239 USA TEL: 313 592 2705 FAX: 313 592 2381 From takagi@diva.Berkeley.EDU Fri Feb 5 03:41:32 1993 Date: Thu, 4 Feb 93 18:41:31 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: BISC Special Seminar Dear Colleagues: We will hold the BISC Special Seminar at UC Berkeley one day before FUZZ-IEEE'93/ICNN'93. Please forward the following announcement to widely. Hideyuki TAKAGI ----------------------------------------------------------------------- EXTENDED BISC SPECIAL SEMINAR 10:30AM-5:45PM, March 28 (Sunday), 1993 Sibley Auditorium (210) in Bechtel Hall University of California, Berkeley CA 94720 BISC (Berkeley Initiative for Soft Computing) of UC Berkeley will hold a Special Seminar to take advantage of the presence in the San Francisco area of the luminaries attending FUZZ-IEEE'93/ICNN'93. We hope that your schedule will allow you to participate. PROGRAM: 10:30-11:00 Lotfi A. Zadeh (Univ. of California, Berkeley) Soft Computing 11:00-12:00 Hidetomo Ichihashi / Univ. of Osaka Prefecture Neuro-Fuzzy Approaches to Optimization and Inverse Problems 12:00- 1:30 (lunch) 1:30- 2:30 Philippe Smets (Iridia Universite Libre de Bruxelles) Imperfect information : Imprecision - Uncertainty 2:30- 3:30 Teuvo Kohonen (Helsinki University of Technology) Competitive-Learning Neural Networks are closest to Biology 3:30- 3:45 (break) 3:45- 4:45 Michio Sugeno (Tokyo Institute of Technology) Fuzzy Modeling towards Qualitative Modeling 4:45- 5:45 Hugues Bersini (Iridia Universite Libre de Bruxelles) The Immune Learning Mechanisms: Reinforcement, Recruitment and their Applications REGISTRATION: Attendance is free and registration is not required. HOW TO GET HERE: [BART subway from San Francisco downtown] The closest station to the SF Hilton Hotel is the Powell Str. Station. Berkeley is a safe 24 minute ride from the Powell Str. Station. You must catch the Concord bound train and transfer onto a Richmond bound train at the Oakland City Center-12th Str. Station. Trains on Sunday rendezvous every 20 minutes as indicated below. Powell 12th Str. Berkeley 8:17 ---- 8:31 8:31 ---- 8:41 8:37 ---- 8:51 8:51 ---- 9:01 8:57 ---- 9:11 9:11 ---- 9:21 9:17 ---- 9:31 9:31 ---- 9:41 9:37 ---- 9:51 9:51 ---- 10:01 It takes 15-20 minutes on foot from the Berkeley BART Station to reach Bechtel Hall, which is located on the North-East part of campus. Bechtel Hall is just North of Evans Hall, home of the Computer Science Division. North Gate is the nearest campus gate. [TAXI] You can take a taxi from the front of the Berkeley BART Station. Ask the taxi driver to enter from East Gate on campus and let you off at Mining Circle. The tallest building adjacent to the circle is Evans Hall. Bechtel Hall is just north of the Evans. [CAR] Get off at the University Ave. exit from Interstate 80. The east end of University Ave. is the West Gate to UC Berkeley. Most street parking is free on Sunday, but it may be scarce and remember to read the signs. If you feel you must park in a lot, we recommend UCB Parking Structure H which is located at the corner of Hearst and La Loma Avenues. You must buy an all day parking ticket from the vending machine located on the 2nd level (the only one in the structure). You need to prepare 12 quarters. Illegal parking in Berkeley is expensive. CONTACT ADDRESS: Hideyuki TAKAGI, Coordinator of this seminar (takagi@cs.berkeley.edu) Lotfi A. Zadeh, Director of BISC (zadeh@cs.berkeley.edu) Computer Science Division University of California at Berkeley Berkeley, CA 94720 FAX <+1>510-642-5775 From @prg.oxford.ac.uk:hje@robots.oxford.ac.uk Fri Feb 5 10:56:11 1993 Relayed; Fri, 5 Feb 1993 10:56:04 +0100 Fri, 5 Feb 1993 10:55:52 +0100 Fri, 5 Feb 1993 10:55:16 +0100 Fri, 5 Feb 1993 10:54:09 +0100 Fri, 5 Feb 1993 10:54:01 +0100 Fri, 5 Feb 1993 10:54:12 +0100 Fri, 5 Feb 1993 10:54:12 +0100 Date: Fri, 5 Feb 1993 10:54:12 +0100 From: hje@robots.oxford.ac.uk Subject: Special Issue of Fuzzy Sets and Systems Call For Papers Special Issue of Fuzzy Sets and Systems on Fuzzy Control 1994 will mark 20 years since the publication of the first paper on fuzzy control by Assilian and Mamdani. Since then, fuzzy control has seen many significant developments, with dedicated fuzzy control chips and working applications in industry, manufacturing, consumer products and many more. A special issue of Fuzzy Sets and Systems will mark this anniversary. Papers are solicited on the theory, applications and hardware used in fuzzy control. Papers reviewing applications in particular sectors are welcome. Prospective authors are invited to contact the editor of the special issue. All papers will be subject to the usual refereeing procedures. The special issue is planned to appear in early 1994. Authors should submit their papers by 15 September 1993 to allow adequate time for refereeing and revision. Please contact Janet Efstathiou if you would like to submit a paper for the special issue. Further information and instructions for authors may be obtained from Dr H-J Zimmermann, Editor, Fuzzy Sets and Systems, RWTH Aachen, Templergraben 64, D-5100 Aachen, 5-Obergeschoss, Germany. Janet Efstathiou Editor of Special Issue. Department of Engineering Science, Oxford University, Parks Road, Oxford OX1 3PJ UK From takagi@diva.Berkeley.EDU Mon Feb 8 08:59:43 1993 Date: Sun, 7 Feb 93 10:56:24 -0800 From: takagi@diva.Berkeley.EDU (Hideyuki Takagi) Subject: attendance restriction at BISC Special Seminar ORGANIZATIONAL CHANGE in Extended BISC Special Seminar 10:30AM-5:45PM, March 28 (Sunday), 1993 Sibley Auditorium (210) in Bechtel Hall University of California, Berkeley CA 94720 Dear Colleagues: This is to inform you of an organizational change in the Extended BISC Special Seminar which was announced on February 4. Most of speakers in the regular BISC Seminar are associated with companies and universities in the Bay area. The motivations for the Extended BISC Seminar was to take advantage of the presence in the Bay area of some of the leading contributors to fuzzy logic and neural network theory from abroad, who will be participating in FUZZ-IEEE'93 / ICNN'93. A problem which became apparent is that because both the Extended BISC Seminar and the FUZZ-IEEE'93/ICNN'93 tutorials are scheduled to take place on the same day, the BISC Seminar may have an adverse effect on registration for the conference tutorilas. To resolve this problem, it was felt that it may be nessary to restrict attendance at the Extended BISC Seminar to students and faculty in the Bay area who normally attend the BISC Seminar. In this way, the Extended BISC Seminar would serve its usual role and at the same time bring to the Berkeley Campus some of the leading contributors to soft computing. The publicity for the Extended BISC Seminar will state that attendance is limited to students and faculty in the Bay area. Sincerely, BISC (Berkeley Initiative for Soft Computing) --------------------------------------------- From RFULLER@finabo.abo.fi Mon Feb 8 10:18:39 1993 <01GUH6R9OESGA0UVUH@finabo.abo.fi>; Mon, 8 Feb 1993 11:18:27 EET Date: 08 Feb 1993 11:18:27 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Who is Who in Fuzzy-Mail Mime-Version: 1.0 Dear colleagues, I would like to create a file titled "Who is Who in Fuzzy-Mail", which would contain descriptions of the scientific activities of the members, and could be of the following form ------------------------------------------------------------------- Robert Fuller (Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-811-976) is interested in - using fuzzy reasoning techniques for solving fuzzy mathematical programming problems, - linear and nonlinear systems with fuzzy numbers, t-norm-based-operations on fuzzy sets, - fuzzy control, - neuro-fuzzy techniques for medical diagnostics Remark: The actual address for correspondence is Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654754, fax: 358-21-654732, e-mail: rfuller@finabo.abo.fi. ------------------------------------------------------------------- This file could help us to create new scientific cooperations and projects, and would be available through fuzzy-mail. Please send me (rfuller@finabo.abo.fi) the record of your scientific interests and addresses for correspondence. Further suggestions as to "Who is who in Fuzzy-Mail" are welcome! I am looking forward to hearing from you soon. Robert Fuller From eytan@dpt-info.u-strasbg.fr Mon Feb 8 11:06:28 1993 (5.65c8/IDA-1.4.4 for ); Mon, 8 Feb 1993 11:06:58 +0100 Date: Mon, 8 Feb 1993 11:06:43 +0100 From: eytan@dpt-info.u-strasbg.fr (Michel Eytan, LILoL) Subject: Re: Who is Who in Fuzzy-Mail >Dear colleagues, > >I would like to create a file titled "Who is Who in Fuzzy-Mail", >which would contain descriptions of the scientific activities of >the members, and could be of the following form > >------------------------------------------------------------------- > > Robert Fuller (Department of Computer Science, Eotvos Lorand >University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, >fax: 36-1-811-976) is interested in > > - using fuzzy reasoning techniques for solving fuzzy mathematical > programming problems, > > - linear and nonlinear systems with fuzzy numbers, > t-norm-based-operations on fuzzy sets, > > - fuzzy control, > > - neuro-fuzzy techniques for medical diagnostics > >Remark: The actual address for correspondence is Department of Computer >Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, >Finland, phone: 358-21-654754, fax: 358-21-654732, >e-mail: rfuller@finabo.abo.fi. > >------------------------------------------------------------------- > >This file could help us to create new scientific cooperations and >projects, and would be available through fuzzy-mail. > >Please send me (rfuller@finabo.abo.fi) the record of your scientific >interests and addresses for correspondence. > >Further suggestions as to "Who is who in Fuzzy-Mail" are welcome! > >I am looking forward to hearing from you soon. > >Robert Fuller Fellow Netters, moderately knowledgeable people with unix boxes put this sort of information in their .plan file, so when one fingers them, one gets it for free. Try eg the command 'finger eytan@suzuka.u-strasbg.fr' on your unix box (or the 'finger' box in Eudora on a Mac, or the 'Finger' appli -- 1st one free, 2nd available for $5.00 shareware) and see what happens... -- Michel Eytan, U. Strasbourg II eytan@dpt-info.u-strasbg.fr Lab Info, Log & Lang, Dpt. Info V: +33 88 41 74 29 22 rue Descartes, 67084 Strasbourg F: +33 88 41 74 40 From bonarini@IPMEL2.ELET.POLIMI.IT Mon Feb 8 13:29:37 1993 (Mailer R2.08 PTF008) with BSMTP id 1066; Mon, 08 Feb 93 13:06:36 MEZ <01GUHAKEC7EO984ZZ2@icil64.cilea.it>; Mon, 8 Feb 1993 13:06:25 +01 8 Feb 93 13:11:06 GMT Date: 08 Feb 1993 13:11:06 +0000 (GMT) From: bonarini@IPMEL2.ELET.POLIMI.IT Subject: Re: Who is Who in Fuzzy-Mail Dear Robert, I find your idea really interesting!! Here is my record: ------------------------------------------------------------------- Andrea Bonarini (Politecnico di Milano Artificial Intelligence and Robotics Project, Dipartimento di Elettronica e Informazione, Politecnico di Milano, Piazza Leonardo da Vinci, 32, I-20133 Milano, Italy, Phone +39 2 2399 3525, Fax +39 2 2399 3587) is interested in - automatic learning of fuzzy rulebases by using evolutionary approaches (Genetic Algorithms, ...) (main application: mobile robots) - integration of fuzzy and traditional control systems (application: robotics) - fuzzy simulation (application: industrial plants, robotics) - uncertainty management (application: multi-model based diagnosis of industrial plants, car driver modeling, DSS) ------------------------------------------------------------------- Thank you!! Why not suggest to Wolfgang Slany to ask this information to people subscribing for the fuzzy mailing list? Regards, Andrea Andrea Bonarini Politecnico di Milano - Dipartimento di Elettronica e Informazione Politecnico di Milano AI & Robotics Project Piazza Leonardo da Vinci, 32 I - 20133 Milano - Italy Voice: +39 2 2399 3525 Fax: +39 2 2399 3587 E-mail: bonarini@ipmel2.elet.polimi.it From wsi@altair Mon Feb 8 14:30:46 1993 Date: Mon, 8 Feb 93 14:29:41 +0100 From: wsi@altair (Wolfgang Slany) Subject: Re: Who is Who in Fuzzy-Mail > Why not suggest to Wolfgang Slany to ask this information to people > subscribing for the fuzzy mailing list? I wrote the following message into the welcome file sent to new subscribers: ----- Begin Included Message ----- Archives and various informative files can be found by sending the "index" and "get" commands to listserv@vexpert.dbai.tuwien.ac.at, see the explanations in help for full details. One example is the "Who is Who in Fuzzy" file that can be retrieved by sending the command "get listserv whoiswhoinfuzzy" to listserv@vexpert.dbai.tuwien.ac.at To be included in this file, send the correctly formatted entry and all changes to Robert Fuller, e-mail: rfuller@finabo.abo.fi Enjoy! ----- End Included Message ----- An "index" command now yields the following result: ----- Begin Included Message ----- Archive: LISTSERV (path: listserv) -- Files: refcard (1 part, 436 bytes) -- List of available requests This is a brief listing of all recognizable requests flai93_info (1 part, 10547 bytes) -- Latest news regarding the forthcoming conference FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE LINZ (AUSTRIA) June 28-30, 1993 dbai.bib (1 part, 81951 bytes) -- Bibliography of publications from the Information Systems Department at the Technical University of Vienna (Adr: E184/2, Paniglg. 16, A-1040 Wien, Austria, Europe) whoiswhoinfuzzy (1 part, 10000 bytes) -- Who is Who in Fuzzy created and kept up-to-date by Robert Fuller, rfuller@finabo.abo.fi Subarchive: FUZZY-MAIL (path: fuzzy-mail) -- Files: archive (5 parts, 65532, 65508, 65513, 65481, 14545 bytes) ----- End Included Message ----- And sending the command "get listserv whoiswhoinfuzzy" to listserv@vexpert.dbai.tuwien.ac.at yields the following result: ----- Begin Included Message ----- Date: Mon, 8 Feb 93 14:09:14 +0100 Subject: GET LISTSERV WHOISWHOINFUZZY Archive LISTSERV: file whoiswhoinfuzzy, part 1/1, size 10000 bytes: ------------------------------ Cut here ------------------------------ "Who is Who in Fuzzy": this file can be obtained by sending the command "get listserv whoiswhoinfuzzy" to listserv@vexpert.dbai.tuwien.ac.at All updates and changes should be mailed, preferably in the format of other entries of this file, to the administrator of this file, Robert Fuller, e-mail: rfuller@finabo.abo.fi Last update: 930208 ------------------------------------------------------------------- Robert Fuller (Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-811-976) is interested in - using fuzzy reasoning techniques for solving fuzzy mathematical programming problems, - linear and nonlinear systems with fuzzy numbers, t-norm-based-operations on fuzzy sets, - fuzzy control, - neuro-fuzzy techniques for medical diagnostics Remark: The actual address for correspondence is Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654754, fax: 358-21-654732, e-mail: rfuller@finabo.abo.fi. ------------------------------------------------------------------- ------------------------------ Cut here ------------------------------ ----- End Included Message ----- Of course the file contains currently only one entry, but please try to find the time to send your corresponding entry to Robert (please do not send it to fuzzy-mail; it will be distributed via fuzzy-mail by Robert anyway in the near future). Not everybody has access to the "finger" command, and most of us do not fill out their .plan file, so I think the idea of this "Who is Who in Fuzzy" file is good, and I would extend it to include not only fuzzy-mail subscribers but also all other people interested in the field. Robert, you can of course change the format of the file as you like it, but think of having the header information after the "Cut here" line included somehow. Please send me your file as soon as entry submissions die down. Any suggestions are welcome, best regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 From bonarini@IPMEL2.ELET.POLIMI.IT Mon Feb 8 15:14:11 1993 (Mailer R2.08 PTF008) with BSMTP id 2653; Mon, 08 Feb 93 15:13:53 MEZ <01GUHF0AKS3K9851SK@icil64.cilea.it>; Mon, 8 Feb 1993 15:13:45 +01 8 Feb 93 15:18:26 GMT Date: 08 Feb 1993 15:18:26 +0000 (GMT) From: bonarini@IPMEL2.ELET.POLIMI.IT Subject: Re: Who is Who in Fuzzy-Mail ... >moderately knowledgeable people with unix boxes put this sort of >information in their .plan file, so when one fingers them, one gets it for >free. OK, but what Robert proposed has a different purpose. It's different to have ONE place where to look for people (maybe unknown) working on some field, than to browse on machines all over the world... I'm interested in having the possibility to access a list of "fuzzy people" looking for someone who is interested in reaserch activities similar to mine and with who I could directly exchange ideas and informations. To use finger, you should already know who are you looking for. Andrea Bonarini Politecnico di Milano - Dipartimento di Elettronica e Informazione Politecnico di Milano AI & Robotics Project Piazza Leonardo da Vinci, 32 I - 20133 Milano - Italy Voice: +39 2 2399 3525 Fax: +39 2 2399 3587 E-mail: bonarini@ipmel2.elet.polimi.it From nauck@ibr.cs.tu-bs.de Mon Feb 8 16:30:28 1993 From: nauck@ibr.cs.tu-bs.de (Detlef Nauck) Subject: Re: Who is Who in Fuzzy-Mail Date: Mon, 8 Feb 93 16:29:22 MET In-Reply-To: <01GUH6R9OESIA0UVUH@finabo.abo.fi> from "RFULLER@finabo.abo.fi" at Feb 8, 93 10:19:00 am Great idea, here is my contribution: ---------------------------------------------------------------------------- Detlef Nauck (Technical University of Braunschweig, Department of Computer Science, Bueltenweg 74 - 75, W-3300 Braunschweig, Germany, Tel: +49.531.391.3155, Fax: +49.531.391.5936, email: nauck@ibr.cs.tu-bs.de) is interested in - fuzzy control - combinations of neural networks and fuzzy systems, i.e. any kind of neuro-fuzzy approach ____________________________________________________________________________ Best wishes Detlef Nauck ============================================================================== Detlef Nauck Phone: 49.531.391.3155 Dept. of Computer Science Fax : 49.531.391.5936 Technical University of Braunschweig Email: nauck@ibr.cs.tu-bs.de Bueltenweg 74 - 75 W-3300 Braunschweig Germany ============================================================================= From wsi@altair Mon Feb 8 18:45:31 1993 Date: Mon, 8 Feb 93 18:44:28 +0100 From: wsi@altair (Wolfgang Slany) Subject: fuzzy-mail & comp.ai.fuzzy news group gateway Dear subscribers of the fuzzy-mail list, as you may know, an internet news group called comp.ai.fuzzy has recently been created. This unmoderated news group has approximately four interesting articles posted every day, but I cannot forward them to fuzzy-mail since I am too busy. There are several possibilities how to achieve a message exchange between our list and this news group: 1. a direct connection between the list and the news-group with a message duplication avoidance mechanism: this means that every message will appear in the list and in the news-group once. 2. alternatively, I can make automatically a digest of the messages posted to comp.ai.fuzzy and send this digest once or twice a week to our list. No messages of the list will be forwarded to the news group, since no message duplication avoidance can be done in this case. 3. a restricted version of 1., for example sending only in one direction. 4. a human operator is responsible for the feeding in both directions. This is actually the best solution since duplicate-mail and junk-mail can be avoided optimally. For this option, we need a volunteer. I would opt for the first possibility, since it is the easiest to implement and everybody gets everything. For those of you fearing an information overflow, I want to remind you that you can choose already now to get only a digest of fuzzy-mail once a week or when more than 1000 lines (I can change that parameter) have been sent, fully equipped with a table of contents, by sending the command "set fuzzy-mail mail digest" to listserv@vexpert.dbai.tuwien.ac.at I am waiting for your suggestions and opinions, but please mail them directly to me at wsi@vexpert.dbai.tuwien.ac.at in order not to disturb other subscribers. I will summarize after some days. As an appetizer, I forward a message that was recently posted to comp.ai.fuzzy as the next message to fuzzy-mail Best Regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 From wsi@altair Mon Feb 8 18:46:01 1993 Date: Mon, 8 Feb 93 18:44:58 +0100 From: wsi@altair (Wolfgang Slany) Subject: Machine Design article on Fuzzy Logic From: paul@eunet.co.at (Paul Gillingwater) Date: 2 Feb 93 19:56:38 GMT This came from a private mailing list. It is reposted without permission of the original copyright holder. Clear Thinking On Fuzzy Logic *Lawrence A. Berardinis MACHINE DESIGN / 23 APR 92 / 46:52* "So ... if a woman weighs as much as a duck ... then she floats ... and is therefore ... " "A witch!" "A WITCH! A WITCH! BURN HER! BURN HER!" Fuzzy logic may sound like the domain of Monty Python or zealots that lecture you on street corners, but it is in reality a computing technique that has extensive use in control systems for a wide variety of devices -- cameras, vehicles, household appliances, or any machine that can take advantage of computing control. The name "fuzzy logic" is unfortunate, since it seems to imply a subject that is neither well-defined nor practical. It is in reality both: fuzzy logic is a reasoned mathematical concept that has found extensive use in applications as a cost-effective and efficient approach to control. Firms such as Boeing, General Motors, Allen-Bradley, Chrysler, Eaton, and Whirlpool are incorporating fuzzy logic into their products to provided low-power refrigerators, advanced automotive transmissions, and motors that operate more efficiently. Although fuzzy theory was developed in the US over 25 years ago, Japanese manufacturers such as Canon, Hitachi, Matsushita, Nissan, and Omron cooperated to put it into production for such products as cameras, trains, air conditioners, and vacuum cleaners, using the technology to meet design objectives that could not be met with conventional techniques. Fuzzy logic is useful because of its economy and smooth operation. It provides accurate and continuous control using low-cost sensors and 4-bit or 8-bit microcontrollers; it is tolerant of noisy signals and component variations. It also lends itself to fast and easy development, and is extremely well suited to applications where the rules are vague and not rigorously defined. * Progress in artificial intelligence has been slow because computers are designed to perform reasoning operations in well-defined, deterministic sequences -- and are totally incapable of dealing with situations that fall outside of that domain. Consider the reasoning in something as simple as adjusting a thermostat. If you wanted to adjust your thermostat, you would not under normal conditions care about setting it to a precise temperature; you would simply want a "comfortable" temperature, which might be defined as "not very hot AND not very cold". Clear Thinking On Fuzzy Logic 2 Next, you would judge the room temperature as "hot", "warm", "cool", or "cold", according to your general perception of the temperature. In practice, these categories may be indistinct; you might think of the room as being "somewhere between warm and hot". You then use this information to set the thermostat appropriately; a typical "rule" for doing this would be "IF I'm very cold THEN I turn up the heat a lot". The setting would then be the one you normally use to get that result. A person who has a good feel for the thermal dynamics of the house may use 20 to 50 such rules to control the temperature. A computer has no such flexibility. The computer may be programmed to turn on the heat to a specified value when the room temperature drops below 67 F, and turn it off again when it rises above 69 F. More complicated algorithms could be used, but defining such a model would be time-consuming and also inflexible. Fuzzy logic provides a better answer. * Fuzzy logic theory was developed by University of California at Berkeley professor Lofti Zadeh in 1965. Unlike conventional ("crisp") set theory, where objects are either in or out of the set, Zadeh's theory allows objects to have partial membership. Each object can have a membership value that varies continuously from 0 to 1, 0 meaning nonmembership and 1 meaning full membership. (Crisp sets are a special case of fuzzy sets in which the membership function is an impulse function.) Fuzzy sets more easily match human reasoning processes than do crisp sets. Returning to the thermostat example, we could define "very cold" as a "fuzzy variable"; measured temperatures would relate to the "very cold" fuzzy variable through a membership function that gave the degree of membership for a particular temperature. In this case, temperatures below 65 F would, for example, have a membership value ("mu") of 1, while temperatures above 70 F would have a membership value of 0. A curved or (more generally) linear segment joins the range: | very cold mu 1.0 -+ *************** | * | * | * | * | * | * | * +---------------*---------------*------------> temperature (F) 60 65 70 Clear Thinking On Fuzzy Logic 3 In normal practice, a set of overlapping variables -- "very cold", "cold" "slightly cold", "warm", "slightly hot", "hot", and "very hot" -- would be defined: | very cold cold mu 1.0 -+ *************** * | * * * | * * * | * * * * | * * | * * * * | * * * | * * * +---------------*---------------*------------> temperature (F) 60 65 70 Fuzzy logic defines mathematical operations that process such fuzzy data using expert-system "rules" to generate the appropriate system outputs. "Inference" methods determine rule outcome, and "defuzzification" methods convert the outcomes to a specific "crisp" value. Manufacturers can control almost any process by getting an expert to come up with 20 to 50 rules describing his or her decision-making processes. * The coupling of the tolerance of fuzzy logic to the conciseness of rule-based expert systems is the key to the usefulness of fuzzy logic; unfortunately, its use with such rule-based systems caused it to be associated in the US with the artificial intelligence field -- and with the hype that the field came to be associated with in the mid-1980s. Fortunately, the Japanese did not acquire this prejudice, and today fuzzy logic is widely applied in Japanese technology. For example, in Matsushita vacuum cleaners, 4-bit microcontrollers running fuzzy algorithms interrogate dust sensors and adjust suction power accordingly. In Hitachi washing machines, fuzzy processors read load-weight, fabric-mix, and dirt sensors and automatically set the wash cycle for the most efficient use of power, water, and detergent. Fuzzy systems are proving to be the fastest and easiest way to automate low-cost applications using closed-loop control. The Japanese anticipated such benefits, which is one reason why they established the Laboratory for International Fuzzy Engineering (LIFE) in 1988. LIFE is made up of 48 companies that contribute almost $10 million a year towards fuzzy research. Clear Thinking On Fuzzy Logic 4 Fuzzy logic is also useful in high-end applications, such as robotics, data communications, and image analysis. The reason is that it reduces the computing burden associated with the complicated mathematical models it replaces; fuzzy logic models the decision-making process, not the process itself. This is extremely useful if the process is nonlinear or subject to constant variation. For example, a Japanese shipbuilder has used fuzzy logic to automate the controls for dredging ships and overcome the effects of wave motion. * Fuzzy controller systems are the equal of or superior to conventional controller systems in terms of response time and accuracy. They are inherently robust because their decisions include contributions from dozens of rules; if a few rules "misfire" because of a bad sensor or electrical component, for instance, the other rules tend to compensate and keep the output smooth and continuous. Fuzzy controllers can also be easily upgraded by adding new rules and sensor membership functions to reflect new priorities such as energy savings, quiet operation, and less on-off switching; even if the new rules conflict with the old ones, fuzzy math can perform a trade-off to balance the requirements. Fuzzy logic has also been used in complement with conventional controller algorithms; the Environmental Protection Agency has been investigating such an approach for improving the operation of standard variable-speed electrical motors in industrial applications; energy savings of up to 10% are possible. Fuzzy logic can also be used directly to improve the performance of variable- speed drives, as they produce a smoothly-varying analog output, which allows motors to run more efficiently over their full range of operation. Camcorder designers have used fuzzy logic to control autofocusing motors over 127 speeds; conventional software running on similar microcontrollers produces only three motor speeds and causes annoying focus errors. Researchers at NASA-Johnson Space Center have performed simulations showing that fuzzy control can reduce both fuel burn and structural stress in spacecraft maneuvers, using 70% less fuel in attitude-hold runs and 40% less fuel in attitude maneuvers, relative to a conventional digital autopilot. Fuzzy control also more responsive and corrects errors more quickly. * Conventional controller theory is highly concerning with system stability and has an extensive set of mathematical tools for proving stability. In fuzzy systems, engineers must simulate and validate their designs using empirical methods. A good place to start is to make sure that all designs agree with known input-output states, and also produce acceptable results for new data. Clear Thinking On Fuzzy Logic 5 Fuzzy technology is still in its infancy and there are no hard-and-fast rules for its development and implementation. Developers must still consider issues such as the optimum shape of membership functions, what inference methods to use, and how to choose the right defuzzification method. Development systems can help by allowing developers to observe the effects of various approaches and pick the one best suited to their application. Despite these difficulties, fuzzy systems are still easier to program and take less time than conventional controller methods; and development should become even less difficult as new technologies and more standard techniques are development. * Good fuzzy-logic development systems can reduce coding and debugging time, as well as simplify tuning and optimization. Changes to rules and membership functions should be quick and easy, and developers should be free to choose between different inference and defuzzification methods. Developers should also have the option of leaving source code generation to the system so they can focus on design. Leading the pack of toolmakers is Togai Infralogic INC, of Irvine, California. Togai's TILShell is an object-based development system that allows users to work in a graphical windows environment. It interfaces with a fuzzy-C development system to automatically develop C source code. In addition, Togai supports many 8 and 16-bit microprocessors with fuzzy kernels and compilers. Other tools provide graphical analysis to help users evaluate applications; and a automated rule-based generator that uses neural-network techniques to analyze input-output definitions and generate a corresponding rule base. Togai also provides several hardware solutions, including plug-in boards and development modules. At the heart of these systems is a digital fuzzy processor called the FC110, which can perform high-speed fuzzy control by processing rules in parallel. Other outfits -- such as Aptronix INC of San Jose, California; Hyperlogic Corp of Escondido, California; Integrated Systems INC of Santa Clara, California; Ursic Computing of Madison, Wisconsin; and American NeuraLogix INC of Sanford, Florida -- make fuzzy hardware and software. As the field continues to grow, more companies will enter the market with a wider range of products. Clear Thinking On Fuzzy Logic 6 Shaping Up Membership Functions With Hedges * One of the tools of the fuzzy programmer are so-called "hedges". Hedges modify fuzzy sets by changing the shape of their membership functions. Hedges are the set-mathematics equivalent of adverbs and adjectives in speech; common hedges include: % "very" % "slightly" % "too" % "extremely" % "somewhat" These are operations with precise definitions; "very", for example, intensifies fuzzy variables by squaring their membership values; since membership values are always 1 or less, this reduces the lower values more than the higher ones. If even greater narrowing is required, "extremely" can be used to cube membership values. The hedge "somewhat", on the other hand, defocuses fuzzy values by taking the square root. Another common hedge is "not", which subtracts membership values from 1 and uses the difference. In the case of fuzzy variables that refer to limits, such as "cold", hedges slide the membership curve up or down the scale. | membership 1.0 -+ * value (mu) | ***** | * * * * * | * * * * * | * * * * * | * * * * * | * * * * * | * * * * * | * * * * * | * * * * * | * * * * * | * * * * * +------------------------------------------------------- 1 2 3 4 5 | Crisp three | | +------ Very three -----+ | | +------------------ Fuzzy three ----------------+ Clear Thinking On Fuzzy Logic 7 The Ins & Outs Of Fuzzy Computing * Fuzzy computers are simple. They consist of an input stage, a processing stage, and an output stage. The input stage converts data inputs to fuzzy equivalents. The processing stage then uses these equivalents to solve fuzzy-logic rules. Finally, the output stage converts fuzzy results back to real numbers. Input data are "fuzzified" by plugging them into membership functions. In decision systems, input may consist of financial statistics, personal and biographical data, medical results, and so on. In control systems, input comes largely from feedback sensors but may also include signals from joysticks, transmitters, potentiometers, and switches. "Fuzzification" simply returns a membership or truth value for each input stage. Membership functions play a key role in fuzzy computing. Their shape and location help determine how well the system works. The most common shape is triangular, although trapezoidal and bell curves are also used; in general, the shape is less critical than the number of curves and location. Three to seven curves should span the "universe of discourse" (in more conventional terms, the range) for the fuzzy set, overlapping each other by 50%. The processing stage in a fuzzy computer is based on a collection of logic rules. These rules are often in the form of IF-THEN statements, where the IF part is called the "antecedent" and the THEN part is called the "consequent". In control applications, the antecedent is usually an error or error-rate signal based on a sensor reading, and the consequent is a control command output. Consider a rule for a thermostat: IF (temperature is "cold") THEN (heater is "high") This rule uses the truth value of (temperature is "cold") as a weighting factor to determine the influence of (heater is "high") on the final conclusion. Most fuzzy systems have dozens of rules, and their outcomes contend to influence the conclusion. In this example, the more (temperature is "cold"), the greater effect (heater is "high") will have on the set point. Fuzzy rule sets usually have several antecedents that are combined using fuzzy operators. The combination is called a "premise", and it generates a single truth value that determines the rule's outcome. Fuzzy operators include AND and OR; the AND operator assigns the minimum truth value to the premise, while the OR operator assigns the maximum value to the premise. Fuzzy rules "fire" to a degree determined by the premises' truth value. In contrast, conventional logic rules fire 100%, or not at all. The problem with all-or-none firing is that borderline case are totally ignored. Also, because branch commands are crisp, program control changes abruptly as rule conditions are met. Clear Thinking On Fuzzy Logic 8 In effect, rules link input truth values to output fuzzy variables. Solving a rule determines a portion of the output variable -- an area under a curve -- that is used to find the conclusion for a system of rules. The process is called an "inference", and there are several methods in practice. One inference method, called max-min, clips the output fuzzy variable at the truth value generated by the premise. The area under the clip line is the rule outcome. Another method is called max-dot or max-product, where the output fuzzy variable is scaled to peak at the premise truth value. The two inference methods produce similar results. +--------------------------------------------------------------------------+ | | | * * | | * * | | * * | | * * | | * * | | * * | | * * | | * * | | Premise truth value, mu(p) ********************** | | ************************** | | ****************************** | | ************************************ | | *********************************************** | | ***************************************************************** | | | +--------------------------------------------------------------------------+ | MAX-MIN clips fuzzy output set at mu(p) | +--------------------------------------------------------------------------+ | | | * * | | * * | | * * | | * * | | * * | | * * | | * * | | * * | | Premise truth value, mu(p) * ** * | | * ****** * | | * ******** * | | * ********** * | | * ****************** * | | * ***************************** * | | | +--------------------------------------------------------------------------+ | MAX-DOT scales fuzzy output set to peak at mu(p). | +--------------------------------------------------------------------------+ Clear Thinking On Fuzzy Logic 9 +----------------------------------------------------------------------------+ | | | | | | | A * | | * D | | * * | | * * | | * * | | * * | | * * | mu(x) mu(x) | * * | | * * -----+---------------+ x x x x x | | * |* | IF x is A | x x x x x x | | * | * | THEN n is D | x x x x x x x | | * | * | | x x x x x x x x | | -------------+------+ +----------------------------------- | | x | | | | | | B * | | * E | | * * | mu(y) mu(y) | * * | | * * -------+---------------+-------------- y y y | | * |* | IF y is B | y y y y | | * | * | THEN n is E | y y y y y | | * | * | | y y y y y y | | * | * | | y y y y y y y | | * | * | | y y y y y y y y | | -----------+--------+ +----------------------------------- | | y | | | | | | C * | | * F | | * * | | * * | | * * | | * * | | * * | | * * | | * * | | * * | | * * | mu(z) mu(z) | * * | | * * ---+---------------+------------------ z z z z z z z | | * |* | IF z is C | z z z z z z z z | | ---------------+----+ THEN n is F +----------------------------------- | | x | | | | | | | | | | | | E | | | y y y | | CENTROID DEFUZZIFICATION | D y y y y | | using max-min inferencing | x x x x x y y y y | | | x x x x x x y y y y F | | | x x x x x x x y y y y z z z z | | | x x x x x x x x y y y y z z z z | | +----------------------------------- | | ^ | | n | | | +----------------------------------------------------------------------------+ Clear Thinking On Fuzzy Logic 10 Rules can be solved in parallel or sequentially, depending on whether the fuzzy system is implemented in hardware or software. Clipped or scaled output variables are added to create a composite fuzzy set. The set is converted ("defuzzified") to a real number by one of of several methods. The most common defuzzification method is the "centroid" method. As the name implies, the center of mass for the composite set becomes the final output value (see illustration on previous page). Another method is the "height" method, which simply takes the number corresponding to the highest membership value. The height method favors the rule with the highest antecedent truth value, while the centroid method is more sensitive to fuzzy outputs with the greatest area. To see how the various processing methods work together, consider one of Mitsubishi's industrial air conditioners. The controller, designed by Togai Infralogic, uses 25 heating rules, 25 cooling rules, triangular membership functions, max-product inferencing, and centroid defuzzification. A temperature sensor provides the input, and control outputs are fed to an inverter, a compressor valve, and a fan motor. Compared to the conventional design, the fuzzy system heats and cools five times faster, reduces power consumption by 24%, increases temperature stability by a factor of 2, and uses fewer sensors. -- Paul Gillingwater Home system: paul@actrix.co.at (Waffle) From zuliang@iss.nus.sg Tue Feb 9 07:08:07 1993 Subject: Re: BISC Special Seminar In-Reply-To: Your message of "Fri, 05 Feb 93 03:41:54 +0100." <9302050241.AA02415@diva.Berkeley.EDU> Date: Tue, 09 Feb 93 14:10:30 +0800 From: zuliang@iss.nus.sg Hi there, Thank you very much for sending me the articles in the Japan SOFT Journal. Those articles are very interesting for me and Liya. Best regards Zuliang From roman@ece.tuwien.ac.at Tue Feb 9 15:52:57 1993 id <22163-0@mailsrv.edvz.univie.ac.at>; Tue, 9 Feb 1993 15:52:57 +0100 Tue, 9 Feb 93 15:49:52 +0100 Date: Tue, 9 Feb 93 15:49:52 +0100 From: roman@ece.tuwien.ac.at (Roman Weissgaerber) Subject: 2nd Austrian Fuzzy Day The institute of computertechnik / technical university of vienna proudly presents: --------------------------------------------------------------------- 2`ND AUSTRIAN FUZZY DAY held on friday February 26th, 1993 at the Technical University Vienna, room EI8 Gusshausstr. 27-29 A-1040 Vienna, Austria All talks will be given in german. PROGRAM: 9:00-10:00 Prof. Laszlo Koczy Department of Telecomunications and Telematics Technical University of Budapest Hierarchisch strukturiertes Fuzzy Control 10:00-11:00 Prof. Klaus-Peter Adlassnig Institut fuer medizinische Computerwissenschaften Universitaet Wien Die Anwendung der Theorie der Fuzzy-Sets im medizinischen Konsultationssystem CADIAG-2 11:00-12:00 Doz. Erich-Peter Klement Fuzzy Logic Laboratorium Linz Johannes Kepler Universitaet Operatoren in Fuzzy Logic 13:00-17:00 discussion about the present state of fuzzy logic in austria REGISTRATION: Attendance is free and registration is not required. CONTACT ADRESS: Robert Geissler, Coordination ( robert@ict.tuwien.ac.at) Roman Weissgaerber ( roman@ece.tuwien.ac.at) Institut fuer Computertechnik Technical University of Vienna Gusshausstr. 27-29 / 384 A-1040 Vienna, Austria FAX: ++43-1-505 38 98-4 From rhaber@iai.es Wed Feb 10 12:30:29 1993 Relayed; Wed, 10 Feb 1993 12:40:28 +0100 Wed, 10 Feb 1993 12:41:04 +0100 Wed, 10 Feb 1993 12:40:41 +0100 Wed, 10 Feb 1993 11:20:24 +0100 Date: Wed, 10 Feb 1993 11:20:24 +0100 Conversion: Prohibited From: Rodolfo Haber Subject: Fuzzy mail help set recipients information lists From wsi@altair Wed Feb 10 13:14:53 1993 Date: Wed, 10 Feb 93 13:19:53 +0100 From: wsi@altair (Wolfgang Slany) Subject: message from the fuzzy-mail coordinator & Aptronix E-mail Server (fuzzynet@aptronix.com) I thought the article at the end of this mail recently posted on comp.ai.fuzzy might interest subscribers of fuzzy-mail. By the way, if you are subscriber of fuzzy-mail and have not access to the news such as comp.ai.fuzzy, but would be interested to read them, could you please send me a message to wsi@vexpert.dbai.tuwien.ac.at, I shall be very obliged ... I need to know how many people have actually no access to the news but would be interested in getting them by fuzzy-mail. If there is no interest, I will drop the idea of making a connection. Something else concerning the fuzzy-mail list: sometimes new subscribers send commands to the list instead of sending them to the listserv address, and I have currently no other way to avoid this kind of wrongly addressed mail than to educate the concerned person afterward ... BUT I will upgrade the listserv-software as soon as the new version 6.0 has been tested (currently in beta release test stage), and this new version will reject messages containing only commands to the listserv software. In the mean time I apologize for the disturbance ... Best Regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 ----- Begin Included Message ----- >From irwin@aptronix.com 5 Feb 93 01:18:41 GMT From: irwin@aptronix.com (Scott Irwin) Subject: Aptronix E-mail Server (fuzzynet@aptronix.com) Summary: FuzzyNet files available on internet Date: 5 Feb 93 01:18:41 GMT Expires: Mon, 8 Mar 1993 01:18:42 GMT We are glad to announce that the Aptronix FuzzyNet files are available through e-mail. You can retrieve files by sending e-mail to fuzzynet@aptronix.com Useful comamnds are: help index send >>> Examples: > Get the help file begin send help end > Search for files motor.ps and caf51-100 begin search motor.ps caf51-100 end > Index Search for files containig words "fide" or "fuzzy" begin index fide fuzzy end > Get the files motor.ps.Z and caf51-100.Z begin send motor.ps.Z caf51-100.Z end We are also happy to include your moderate length technical reports on the FuzzyNet server. Please send your report to irwin@aptronix.com. (We reserve the right to defuzzify the meaning of moderate length!) === introduction.txt === Listed below is a brief description of the files available on the Aptronix Email server (fuzzynet@aptronix.com): (This file will be updated monthly.) Application Notes: ================== All of the application notes are in PostScript format (compressed) . wash_mach.ps.Z -- The explanation of how fuzzy logic is used in a washing machine using a 2 input and 1 output fuzzy logic controller. focus.ps.Z -- Description of how fuzzy logic is used to automatically focus a camera's image with a 3 input and 3 output controller. motor.ps.Z -- A two input and one output servo motor controller. glass_fu.ps.Z -- Temperature controller with 2 inputs and one output used in a glass melting furnace air_cond.ps.Z -- Description of how fuzzy logic is used to control an air conditioner. reactor.ps.Z -- Sophisticated industrial reactor temperature controller with 3 inputs and 2 outputs. auto_trn.ps.Z -- Four input and one output controller for an automobile transmission. 2invpdlm.ps.Z -- Details of the actual two-stage inverted pendulum system built by Aptronix. fctirev.ps.Z -- Fuzzy Logic : From Concept To Implementation. Fide related information ======================== fide.txt -- Aptronix fide brochure (text only) pid-fuz.txt -- Comparing PID Control to Fuzzy Logic Based Control comp.ai.fuzzy archives ====================== caf1-50.Z -- Articles 1-50 on comp.ai.fuzzy (caf) caf101-150.Z -- Articles 101-150 on comp.ai.fuzzy caf51-100.Z -- Articles 51-100 on comp.ai.fuzzy Contributions ============= Brubaker - Huntington Technical Brief brub1.txt -- A Fuzzy Web Tension Controller - January 15, 1992 brub2.txt -- Dynamic Extent of Fuzzy Variables - February 15, 1992 brub3.txt -- Hedges - June 15, 1992 brub4.txt -- Fuzzy Evidence in Character Recognition - July 15, 1992 brub5.txt -- Fuzzy Environmental Control - October 92 brub6.txt -- Fuzzy References (books) - November 92 brub7.txt -- Pseudo-Fuzzy, Table-Driven Kernel - December 92 brub8.txt -- Fuzzy System Design Rules of Thumb - January 93 ----------- Scott Irwin irwin@aptronix.com ----- End Included Message ----- From rhaber@iai.es Wed Feb 10 14:22:34 1993 Relayed; Wed, 10 Feb 1993 14:22:33 +0100 Wed, 10 Feb 1993 14:23:08 +0100 Wed, 10 Feb 1993 14:22:40 +0100 Wed, 10 Feb 1993 13:17:29 +0100 Date: Wed, 10 Feb 1993 13:17:29 +0100 Conversion: Prohibited From: Rodolfo Haber Subject: Apollogise My lack of knowledge about this system leaded me to that error. I apollogise. Haber From gebhardt@gmdzi.gmd.de Wed Feb 10 14:26:32 1993 (5.65c/IDA-1.4.4 for ); Wed, 10 Feb 1993 14:24:53 +0100 Date: Mit, 10 Feb 1993 14:28:14 +0100 From: gebhardt@gmd.de (Friedrich Gebhardt) Subject: Re: message from the fuzzy-mail coordinator & Aptronix E-mail Server (fuzzynet@aptronix.com) Da ich comp.ai.fuzzy lese, habe ich ein Interesse daran, dasselbe NICHT noch einmal per Post zu bekommen. Mit freundlichen Gruessen Friedrich Gebhardt ----- Friedrich Gebhardt, GMD, Postfach 13 16, D-W-5205 Sankt Augustin 1 Ruf 02241-14-2660, Fax 02241-14-2084 Elektronische Post: gebhardt@gmd.de From eytan@dpt-info.u-strasbg.fr Wed Feb 10 15:24:22 1993 (5.65c8/IDA-1.4.4 for ); Wed, 10 Feb 1993 15:24:53 +0100 Date: Wed, 10 Feb 1993 15:24:42 +0100 From: eytan@dpt-info.u-strasbg.fr (Michel Eytan, LILoL) Subject: Re: message from the fuzzy-mail coordinator & Aptronix E-mail Server Da ich comp.ai.fuzzy NICHT lese, habe ich ein Interesse daran, dasselbe JA noch einmal per Post zu bekommen. Mit freundlichen Gruessen -- Michel Eytan, U. Strasbourg II eytan@dpt-info.u-strasbg.fr Lab Info, Log & Lang V: +33 88 41 74 29 22 rue Descartes, 67084 Strasbourg FR F: +33 88 41 74 40 From robert@ece.tuwien.ac.at Thu Feb 11 18:51:32 1993 id <17858-0@mailsrv.edvz.univie.ac.at>; Thu, 11 Feb 1993 18:51:32 +0100 Thu, 11 Feb 93 18:48:27 +0100 Date: Thu, 11 Feb 93 18:48:27 +0100 From: robert@ece.tuwien.ac.at (Robert Geissler) Subject: Re: message from the fuzzy-mail coordinator & Aptronix E-mail Server > From fuzzy-mail@vexpert.dbai.tuwien.ac.at Wed Feb 10 14:37:26 1993 > Date: Wed, 10 Feb 93 14:28:53 +0100 > Comment: Fuzzy Distribution List > Originator: fuzzy-mail@vexpert.dbai.tuwien.ac.at > Reply-To: fuzzy-mail > Sender: fuzzy-mail@vexpert.dbai.tuwien.ac.at > Version: 5.5 -- Copyright (c) 1991/92, Anastasios Kotsikonas > From: gebhardt@gmd.de (Friedrich Gebhardt) > To: Multiple recipients of list > Subject: Re: message from the fuzzy-mail coordinator & Aptronix E-mail Server > Content-Length: 314 > > Da ich comp.ai.fuzzy lese, habe ich ein Interesse daran, dasselbe NICHT > noch einmal per Post zu bekommen. > > Mit freundlichen Gruessen Friedrich Gebhardt > ----- > Friedrich Gebhardt, GMD, Postfach 13 16, D-W-5205 Sankt Augustin 1 > Ruf 02241-14-2660, Fax 02241-14-2084 > Elektronische Post: gebhardt@gmd.de > > > Zum Zeitpunkt der Sendung war es nicht klar ob fuzzy-mail einen forward auf comp.ai.fuzzy macht. Wird nicht wieder vorkommen. MfG Robert Geissler From marco@iai.es Fri Feb 12 10:09:50 1993 Relayed; Fri, 12 Feb 1993 10:09:30 +0100 Fri, 12 Feb 1993 10:10:09 +0100 Fri, 12 Feb 1993 10:09:47 +0100 Fri, 12 Feb 1993 09:02:46 +0100 Date: Fri, 12 Feb 1993 09:02:46 +0100 Priority: Urgent Conversion: Prohibited From: "Marco T. C. de Andrade" Subject: Apenas uma pergunta Importance: High >>>> Da ich comp.ai.fuzzy lese, habe ich ein Interesse daran, dasselbe NICHT >>>> noch einmal per Post zu bekommen. >>>> >>>> Mit freundlichen Gruessen Friedrich Gebhardt >>>> ----- >> >>Zum Zeitpunkt der Sendung war es nicht klar ob fuzzy-mail einen forward auf >>comp.ai.fuzzy macht. Wird nicht wieder vorkommen. >>MfG Robert Geissler Qual e' o "idioma oficial" a ser utilizado na rede? Lembrem-se que perguntar nao ofende. Muito obrigado, Marco Tulio. (marco@iai.es) From eytan@dpt-info.u-strasbg.fr Fri Feb 12 10:42:11 1993 (5.65c8/IDA-1.4.4 for ); Fri, 12 Feb 1993 10:42:34 +0100 Date: Fri, 12 Feb 1993 10:42:25 +0100 From: eytan@dpt-info.u-strasbg.fr (Michel Eytan, LILoL) Subject: Valasz -- was: Re: Apenas uma pergunta >>>>> Da ich comp.ai.fuzzy lese, habe ich ein Interesse daran, dasselbe NICHT >>>>> noch einmal per Post zu bekommen. >>>>> >>>>> Mit freundlichen Gruessen Friedrich Gebhardt >>>>> ----- >>> >>>Zum Zeitpunkt der Sendung war es nicht klar ob fuzzy-mail einen forward auf >>>comp.ai.fuzzy macht. Wird nicht wieder vorkommen. >>>MfG Robert Geissler > >Qual e' o "idioma oficial" a ser utilizado na rede? >Lembrem-se que perguntar nao ofende. > >Muito obrigado, > > > Marco Tulio. > (marco@iai.es) Szerintem a listanak hivatalos nyelve az Angol de ha ott vagytok Magyar elvtarsok, hajlando vagyok e nyelven targyalni veletek. The 1st message was apparently sent by mistake. ~=michel eytan@dpt-info.u-strasbg.fr From Keresztfalvi@wiwi.uni-frankfurt.dbp.de Fri Feb 12 11:43:02 1993 Relayed; Fri, 12 Feb 1993 11:43:01 +0100 Fri, 12 Feb 1993 11:43:44 +0100 Fri, 12 Feb 1993 11:43:26 +0100 Fri, 12 Feb 1993 11:41:18 +0100 Fri, 12 Feb 1993 11:41:15 +0100 Fri, 12 Feb 1993 11:41:16 +0100 Date: Fri, 12 Feb 1993 11:41:16 +0100 From: Tibor Keresztfalvi Subject: Re: Valasz -- was: Re: Apenas uma pergunta >>>>>> Da ich comp.ai.fuzzy lese, habe ich ein Interesse daran, dasselbe NICHT >>>>>> noch einmal per Post zu bekommen. >>>>>> >>>>>> Mit freundlichen Gruessen Friedrich Gebhardt >>>>>> ----- >>>>>> ----- >>>>Zum Zeitpunkt der Sendung war es nicht klar ob fuzzy-mail einen forward auf >>>>comp.ai.fuzzy macht. Wird nicht wieder vorkommen. >>>>MfG Robert Geissler >> >>Qual e' o "idioma oficial" a ser utilizado na rede? >>Lembrem-se que perguntar nao ofende. >> >>Muito obrigado, >> >> >> Marco Tulio. >> (marco@iai.es) > >Szerintem a listanak hivatalos nyelve az Angol de ha ott vagytok Magyar >elvtarsok, hajlando vagyok e nyelven targyalni veletek. > >The 1st message was apparently sent by mistake. > ~=michel eytan@dpt-info.u-strasbg.fr > Termeszetesen vagyunk itt magyarok is, de ezen kivul meg egy csomo mas nyelvet beszelo tarsunk is, ezert megiscsak jobb lenne az angolnal maradni. So, I think we should keep English (even if poor) and not make this file any longer. Tibor Keresztfalvi From RFULLER@finabo.abo.fi Sat Feb 13 15:36:06 1993 <01GUOHBSSNKKAJKPCQ@finabo.abo.fi>; Sat, 13 Feb 1993 16:36:00 EET Date: 13 Feb 1993 16:35:59 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Progress in "Who is Who in Fuzzy-Mail" Mime-Version: 1.0 Dear Colleagues, I am happy to inform you that the "Who is Who in Fuzzy Mail" file (stored as whoiswhoinfuzzy in fuzzy-mail listserver) is growing steadily and it has 18 records now. Thank you very much for your comments and suggestions. The second part of this message contains the recent records of whoiswhoinfuzzy file in alphabetical order. Please keep me sending (rfuller@finabo.abo.fi) your record with your current address and (fuzzy) topics of interests! Every message will be acknowledged! With my best wishes. Robert. bye bye Archive LISTSERV: file whoiswhoinfuzzy, part 1/1, size 10000 bytes: ------------------------------ Cut here ------------------------------ "Who is Who in Fuzzy": this file can be obtained by sending the command "get listserv whoiswhoinfuzzy" to listserv@vexpert.dbai.tuwien.ac.at All updates and changes should be mailed, preferably in the format of other entries of this file, to the administrator of this file, Robert Fuller, e-mail: rfuller@finabo.abo.fi Last update: 930212 ---------------------------------------------------------------------- Andrea Bonarini Politecnico di Milano Artificial Intelligence and Robotics Project, Dipartimento di Elettronica e Informazione, Politecnico di Milano, Piazza Leonardo da Vinci, 32, I-20133 Milano, Italy, Phone +39 2 2399 3525, Fax +39 2 2399 3587 E-mail: bonarini@ipmel2.elet.polimi.it, is interested in - automatic learning of fuzzy rulebases by using evolutionary approaches (Genetic Algorithms, ...) (main application: mobile robots) - integration of fuzzy and traditional control systems (application: robotics) - fuzzy simulation (application: industrial plants, robotics) - uncertainty management (application: multi-model based diagnosis of industrial plants, car driver modeling, DSS) ---------------------------------------------------------------------- ---------------------------------------------------------------------- Patrik Eklund Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654684, fax: 358-21-654732, e-mail: peklund@finabo.abo.fi is interested in - Neural fuzzy systems - Fuzzy logic programming - Fuzzy clustering - Process control - Medical diagnostic - Foundations of fuzzy sets - Fuzzy convergence ---------------------------------------------------------------------- ---------------------------------------------------------------------- Wolfgang Eppler Research Centre for Computer Science, FZI, Haid- und Neustr. 10-14, D-7500 Karlsruhe, Germany, phone: +49-721-9654-449, fax: +49-721-9654-459, e-mail: eppler@fzi.de is interested in - neural fuzzy control - fuzzy control applications - model-based neural controllers - representation of (fuzzy) symbols in neural networks Remarks: Working in this domain since 1989 ---------------------------------------------------------------------- ---------------------------------------------------------------------- Janos C.Fodor Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Budapest, phone: 36-1-1869066, fax: 36-1-1811-976, e-mail: h1367fod@huella.bitnet is active in the following topics: - operations on fuzzy sets, (basic theoretical questions of t-norms, weak t-norms and fuzzy implications) - fuzzy relations, (axiomatic approach to fuzzy preference modeling; different kinds of orders; traces of fuzzy binary relations) - using fuzzy preference modeling in multicriteria decision making problems, (aggregation of preferences, comparison of pre- and post-choice methods; ranking by scoring; consensus via aggregation of decomposable measures) ---------------------------------------------------------------------- ---------------------------------------------------------------------- Robert Fuller Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-811-976) is interested in - using fuzzy reasoning techniques for solving fuzzy mathematical programming problems, - linear and nonlinear systems with fuzzy numbers, t-norm-based-operations on fuzzy sets, - fuzzy control, - neuro-fuzzy techniques for medical diagnostics Remark: The actual address for correspondence is Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654754, fax: 358-21-654732, e-mail: rfuller@finabo.abo.fi. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Jan Jantzen Technical University of Denmark, Electric Power Eng. Dept., building 325, DK-2800 Lyngby, DENMARK, Ph: (+45) 4288 1633, Fax:(+45) 4288 6111 is interested in - fuzzy control: Rule based, table based, self-organising, fuzzy PID, stability, tuning; MATLAB, SIMULINK, C - image processing: object recognition in magneto-resonance images of the human brain, rule based; MATLAB, C - fuzzy logic: array based inference, truth tables, inner / outer products, transitivity; APL, BEOLOGIC ---------------------------------------------------------------------- ---------------------------------------------------------------------- Tibor Keresztfalvi Department of Applied Analysis, Eotvos Lorand University, Muzeum korut 6-8, H-1088 Budapest, Hungary, e-mail: xtibor@ludens.elte.hu investigates - t-norm-based operations on fuzzy intervals, - extended functions (defined via a sup-t-norm convolution), - fuzzy (multiobjective) mathematical programming problems under t-norms, - exact calculation formulas in fuzzy logic. Remark: Recent address: Institut fur Statistik and Mathematik, University of Frankfurt, Mertonstrasse 17-25, W-6000 Frankfurt am Main, fax: 49-69-7983330, e-mail: keresztfalvi@wiwi.uni-frankfurt.dbp.de. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Laszlo T. Koczy Department of Telecommunication and Telematics, Technical University of Budapest, Fax: +361-1812-302 or +361-1666-808, h1256koc@ella.hu or h1256@huella.bitnet is active in the fields - algorithms of fuzzy rule based control (complexity, interpolation, extrapolation, general approximation of rules) - certain aspects of computer vision by fuzzy methods (edge detection, components positions, etc.) - fuzzy hardware components (flip-flops, various circuits) - fuzzy graphs - properties of strictly monotonous norms and corresponding algebraic structures Remarks: Started fuzzy research in 1973. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Sonja Kowalewski University of Koblenz-Landau, Department of Computer Science, Institute of Computational Linguistics, Rheinau 3-4, W-5400 Koblenz, Germany, Phone: +49-261-9119-468, Fax: +49-261-37524, email: kowa@infko.uni-koblenz.de is interested in - fuzzy logic in natural language processing, especially in generating natural language texts (modelling vagueness, ambiguity and acceptability) - fuzzy logic in knowledge representation ---------------------------------------------------------------------- ---------------------------------------------------------------------- Ashutosh Malaviya GMD-FUZZY, German National Research Center for Comp. Sc. Postfach 1316 Tel: +49-2241-14-2751 W-5205 St.Aogustin 1 Fax: +49-2241-14-2342 GERMANY e-mail: malaviya@borneo.gmd.de is presently working on - Online/Offline handwriting recognition using Fuzzy Logic ( Mathematical formula recognition with PenTop and document recognition/analysis ) - Fuzzy Pattern Recognition/ Computer Vision and his research interests include - fuzzy grammars, fuzzy kohonen maps, fuzzy-GA/NNs - Applying Fuzzy Logic in Pattern Recognition and Control Systems - VLSI realization of Fuzzy Solutions ---------------------------------------------------------------------- ---------------------------------------------------------------------- Mikio Nakatsuyama Department of Electronic Engineering, Yamagata University, 992 Japan, Phone: +81-238-22-5181 EXT 329, Fax: +81-238-24-2752) is interested in - neuro-fuzzy control - fuzzy C - neuro-fuzzy expert systems - fuzzy image processing Remark: Address Department of Electronic Engineering, Yamagata University, 4-3-16 Jonan, Yonezawa 992 Japan Phone: +81-238-22-5181 EXT 329, Fax: +81-238-24-2752 E-mail: nakatsu@ea5.yz.yamagata-u.ac.jp ---------------------------------------------------------------------- ---------------------------------------------------------------------- Detlef Nauck Technical University of Braunschweig, Department of Computer Science, Bueltenweg 74 - 75, W-3300 Braunschweig, Germany, Tel: +49.531.391.3155, Fax: +49.531.391.5936, email: nauck@ibr.cs.tu-bs.de is interested in - fuzzy control - combinations of neural networks and fuzzy systems, i.e. any kind of neuro-fuzzy approach ---------------------------------------------------------------------- ---------------------------------------------------------------------- VESA A NISKANEN DEPT. OF ECONOMICS & MANAGEMENT, P.O. BOX 27 (VIIKKI, A-HOUSE), SF-00014 UNIVERSITY OF HELSINKI, FINLAND, Phone: +358 0 708 5052, Fax: +358 0 708 5096 E-mail: niskanen@cc.helsinki.fi is interested in - METHODOLOGICAL PROBLEMS OF FUZZY SYSTEMS - FUZZY REASONING - FUZZY DECISION-MAKING - EDUCATION OF FUZZINESS - FUZZY NEURAL NETS - FUZZY STATISTICS ---------------------------------------------------------------------- ---------------------------------------------------------------------- Wolfgang SLANY Christian Doppler Labor fuer Expertensysteme Abteilung fuer Datenbanken und Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria Tel: +43-1-58801-6123 FAX: +43-1-5055304 email: wsi@vexpert.dbai.tuwien.ac.at is interested in - Fuzzy Constraint Satisfaction Problems and Fuzzy Constraint Relaxation - Fuzzy Scheduling, Knowledge-Based Scheduling, Reactive Scheduling - Industrial Applications of Fuzzy Logic - Advanced User Interfaces - cooperating in ESPRIT IV projects He is the administrator of the European fuzzy-mail list: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send "subscribe fuzzy-mail Your Real Name" as a message to | | listserv@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like "help" to listserv@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ---------------------------------------------------------------------- ---------------------------------------------------------------------- Klaus Stohl VOEST-ALPINE Industrieanlagenbau GmbH, Dept. TAP1, Turmstr. 44, 4031 Linz, Austria, phone: +43 732 592 3631, fax: +43 732 592 2089, e-mail: stohl@vai.co.at is interested in: - building large applications (automation in the steel industry), large means, many inputs, many outputs, long inference chains - fuzzy expert systems - combining fuzzy logic and neural networks ---------------------------------------------------------------------- ---------------------------------------------------------------------- Robert VALETTE LAAS-CNRS, 7 Av. du Colonel Roche, F-31077 TOULOUSE Cedex France, TEL:++33 61336409, FAX:++33 61553577, NET: robert@laas.fr is interested in - using fuzzy reasoning techniques for controlling and monitoring Manufacturing Systems - using fuzzy reasoning on processes (fuzzy date, fuzzy state...) - fuzzy Petri nets, ---------------------------------------------------------------------- ---------------------------------------------------------------------- Prof. J.L. Verdegay Dept. of Computer Science and Artificial Intelligence University of Granada 18071 Granada (Spain) Phone: +34.58.244018, Fax: +34.58.243317, email: jverdegay@ugr.es Areas of research: Fuzzy logic in optimization problems Genetic Algorithms Fuzzy control Approximate Reasoning Decision support systems ---------------------------------------------------------------------- ---------------------------------------------------------------------- Bartel Van de Walle Nuclear Energy Research Center, Boeretang 200, B - 2400 MOL BELGIUM, and State University of Ghent, Applied Mathematics and Computer Science Departement, S9, Krijgslaan 281, 9000 GENT, BELGIUM, Phone +32 14 33 2813, e-mail: vdwalle at bmlsck11.bitnet is interested in: - decision support systems (esp. related to nuclear energy) - uncertainty in decision making - fuzzy data bases - nuclear energy related fuzzy research ------------------------------------------------------------------------ ------------------------------ Cut here -------------------------------- From roman@ece.tuwien.ac.at Sat Feb 13 17:51:15 1993 id <05129-0@mailsrv.edvz.univie.ac.at>; Sat, 13 Feb 1993 17:51:17 +0100 Sat, 13 Feb 93 17:48:10 +0100 Date: Sat, 13 Feb 93 17:48:10 +0100 From: roman@ece.tuwien.ac.at (Roman Weissgaerber) Subject: Who is Who in Fuzzy-Mail One more entry for your "Who is Who in Fuzzy-Mail" file: Roman Weissgaerber Institut fuer Computertechnik Technische Universitaet Wien Gusshausstrasse 27-29/384 A-1040 Vienna, Austria Phone: +43-1-58801-3824 FAX: +43-1-50538984 E-mail: roman@ece.tuwien.ac.at is interested in: - demonstration models of fuzzy control for educational purposes (simulations and real models e.g. small vehicles) - online and offline learning techniques for fuzzy control (Neural Networks, Genetic Algorithms, ...) - Intelligent Fuzzy Control (Fuzzy Controller with multiple levels of reasoning) - Fuzzy Hardware From wsi Sun Feb 14 21:35:04 1993 Date: Sun, 14 Feb 93 21:35:04 +0100 From: wsi (Wolfgang Slany) Subject: Wolfgang Slany is in Japan until February 22, 1993 Apparently-To: fuzzy-mail@vexpert.dbai.tuwien.ac.at Your mail regarding "WARNING: message delayed at "axion.bt.co.uk"" will be read when I return. If you have something urgent, please contact cdlab@vexpert.dbai.tuwien.ac.at or flai93@vexpert.dbai.tuwien.ac.at or, in emergency cases, in Japan: Fax: 0081-592-242032 c/o JINSEI (KOUHOU) Tel: 0081-596-254595 c/o JINSEI You will receive this message only once a week, even if you send me multiple messages during that week. Best Wishes, Wolfgang Slany From poelzleitner@pbox.joanneum.ac.at Tue Feb 16 12:23:36 1993 Date: Tue, 16 Feb 93 12:23:18 GMT Tue, 16 Feb 93 12:23:17 +0000 Posted: Tue, 16 Feb 93 12:20:59 +0000 From: "POELZLEITNER" App-Message-Id: <9359201216021993/A01827/PRZJ00/117283143900> Subject: Image Analysis & Synthesis, OAGM'93 (fz) Dear Friends and Collegues: Today is the deadline for submission of your contributions to the "Image Analysis and Synthesis" workshop in Graz. For those of you who plan a submission, here is some additional information: 1. Although a draft paper is preferable, a 1000-word abstract is sufficient as well. We understand there was a relatively short time between the announcement and the deadline for submission, but we ask you to send your submissions as soon as possible. 2. You can also submit your contribution via e-mail to poelzleitner@joanneum.ada.at Enclosed is another copy of the announcement for those of you who haven't received it yet. We are looking forward to see you in Graz! With best regards, Wolfgang Poelzleitner P.S.: Wie letztes Jahr in Wien, wird es eine eigene Vortragsreihe fuer die Teilnehmer am "Forschungsschwerpunkt Bildverarbeitung" geben, sodass die Tagung auch fuer alle FSP-Antragsteller sehr interessant sein duerfte. 17th OAGM Workshop and 4th International Workshop for Digital Image Processing and Computer Graphics Image Analysis and Synthesis June 2nd - 4th, 1993 Graz, Austria First Announcement and Call for Papers ______________________________________ The Austrian Association for Pattern Recognition (OAGM, which is part of the IAPR) in cooperation with the Austrian Academy of Sciences, the Russian Academy of Sciences, and JOANNEUM RESEARCH invite you to participate in the 3 day Workshop on Digital Image Analysis and Synthesis. Papers devoted to new trends in image analysis and synthesis, including theory, algorithms, and applications are especially welcome. Topics of interest include, but are not limited to, the following: * image processing (analysis and synthesis) * perception engineering * pattern recognition * computer vision * parallel and hierarchical algorithms and architectures * neural networks * remote sensing * medical and biological applications * industrial applications * fuzzy logic theory and applications * active vision * visualization General Information Registration for the workshop will take place from June 2nd, 8:30 throughout the workshop to June 4th, 1993. All papers must be received by February 15th, 1993, and application cards for participation and hotel accommodation must be received by May 1st, 1993. The working language of the workshop will be English. Invited Speakers The invited speakers will be * Professor Bruce Batchelor, of the University of Wales, College of Cardiff * Victor Soyfer, of the Institute for Aviation, Samara, Russia Submission of Papers Authors wishing to present a paper should submit a draft version and/or a 1000 words abstract (for the book of abstracts) by February 15th, 1993. All papers must be submitted in English. Camera-ready-copies according to the OAGM style will be requested after the workshop. Proceedings will be prepared directly by offset printing from authors' manuscripts with no additional editorial processing or retyping. A brochure of abstracts will be provided together with the conference material. The proceedings including all presented papers will be published after the conference. The papers submitted will be reviewed by the programme committee, and the authors will receive a notification of acceptance of their papers. Invitation cards with a final programme and information about location and registration will be sent to the participants. Participation Fee There will be a small participation fee which covers participation in all conference and workshop events, including the social programme and refreshments. Hotel accomodation and meals will be paid for by the participants at their own expense. Special Sessions Several special sessions will be organised around specific topics. So far the following sessions are planned: * industrial applications of image analysis and synthesis methods including system integration and tools * remote sensing, space applications and robotics * an international contact forum * image analysis tools * Mathematica-like image analysis tools To facilitate the comparison of new image analysis algorithms, this special session is devoted to the presentation of implementations in Mathematica, Maple, Matlab, etc. Prospective authors are requested to include suitable input, output data, as well as the source code, as appendices to their algorithm descriptions. This new form of presentation at a workshop should help researchers to speed up the comparison of results, reduce duplication of efforts, as well as provide learning tools for students. International Contact Forum Colleagues from neighbouring countries are invited to present the research activities of their own countries. This forum should establish international contact and facilitate the exchange of ideas. OAGM Prize All presented contributions (including the oral presentation) will be reviewed by the prize committee and the authors of the best paper will be selected to receive the OAGM best-paper award. The schedule is 15th February : Last day of receipt of abstracts or draft papers 1st April 1993 : Notification to authors of acceptance of their papers 1st May 1993 : Participation cards, fees, and hotel reservation cards 2nd June 1993 : Registration of participants 2nd - 4th June 1993 : Conference and workshops 30th August 1993: Publication of proceedings All correspondence should be sent to: Martin Povoden or Wolfgang Polzleitner JOANNEUM RESEARCH Wastiangasse 6 A-8010 Graz Austria Tel.: (+43 316) 8020-752 Fax: (+43 316) 8020-720 e-mail: povoden@joanneum.ada.at or e-mail: poelzleitner@joanneum.ada.at Chairman: W. Polzleitner (A) Co-Chairs: B. Batchelor (UK), V. Soyfer (GUS), H. Wechsler (USA), E. Wenger (A) Organizing Committee: M. Povoden (A), A. Prohammer (A) Program Committee: I. Bajla (Slovakian Academy of Sciences, Bratislava, CSFR) W. Burger (Univ. of California at Riverside, USA) H. Feichtinger (University of Vienna, A) C. Fermueller (Univ. of Maryland, USA) I. Hollaender (Austrian Academy of Sciences, A) V. Karnaukhov (Russian Academy of Sciences, Moscow, GUS) W. Kropatsch (University of Technology of Vienna, A) K. Mayer (Oesterreichisches Forschungszentrum Seibersdorf, A) N. Merzliakov (Russian Academy of Sciences, Moscow, GUS) A. Muir (Scottish Centre for Agricultural Eng., Univ. of Edinburgh, UK) G. Paar (JOANNEUM RESEARCH, Graz, A) A. Pinz (University of Technology, Vienna, A) G. Shubinsky (North Western University, Chicago, USA) D. Strobl (JOANNEUM RESEARCH, Graz, A) G. Schwingshakl (JOANNEUM RESEARCH, Graz, A) E. Wenger (Austrian Academy of Sciences, Vienna, A) L. Yaroslavsky (National Institute of Health, Bethesda, USA) APPLICATION FORM I am interested in the workshop * I have not yet decided to participate ________ * I intend to participate ________ * I intend to present a paper Tentative title: ________________________________________________ * Please inform my colleague Name, Address: ________________________________________________ * Please send me further information about the workshop My e-mail address: ________________________________________________ Send to: Martin Povoden, JOANNEUM RESEARCH, Wastiangasse 6, A-8010 Graz, Austria Tel.: (+43 316) 8020-752 Fax: (+43 316) 8020-720 e-mail: povoden@joanneum.ada.at or e-mail: poelzleitner@joanneum.ada.at Recipient List: renate@sunivf1.boku.ac.at bis@prip.tuwien.ac.at wilbur@constitution.ucr.edu A4422DAJ@helios.edvz.univie.ac.at A8131DAN@helios.edvz.univie.ac.at jansa@egduv1.una.ac.at hkahmen@fbgeo1.tuwien.ac.at krw@prip.tuwien.ac.at gmentes@fbgeo1.tuwien.ac.at tmw@edvz.uni-linz.ac.at pag@pdib36.joanneum.ac.at A4421DAE@helios.edvz.univie.ac.at pichler@edvz.uni-linz.ac.at api@prip.tuwien.ac.at poelzleitner@joanneum.ada.at mroic@fbgeo1.tuwien.ac.at k320870@edvz.uni-linz.ac.at js@cast.uni-linz.ac.at schneiwe@mail.boku.ac.at sid@pdib35.joanneum.ac.at steinnocher@egduv1.una.ac.at stifter@risc.uni-linz.ac.at Strohmer@tyche.mat.univie.ac.at thannen@tyche.mat.univie.ac.at wil@prip.tuwien.ac.at nw@fortec.tuwien.ac.at From knick@faw.uni-ulm.de Tue Feb 16 18:41:12 1993 id AA13751; Tue, 16 Feb 1993 18:38:57 -0600 Date: Tue, 16 Feb 1993 18:38:57 -0600 From: knick@faw.uni-ulm.de (Manfred Knick) Subject: Re: Who is Who in Fuzzy-Mail Hello, my name is Manfred Knick. I am leading a projekt on autonomous mobile systems here at FAW in Ulm, Germany. We would like the machine to understand a little e bit about its environment und use that knowledge in order to improve its performance in order to have a better chance for understanding ... In order to achive this, we try to integrate symbolic and non-symbolic forms if information processing. By the way, the controller for our mobile platform is a fuzzy one - we hesitated to solve the inverse kinematics problem. If you like , please send me some information about you, your institute, your robotics, your idea of integration ... what YOU think is best to start with. My address: FAW Helmholtzstrasse 16 Postfach 20 60 d - 7900 Ulm / Donau GERMANY Yours, kind regards manfred knick From bosc@merlin.enssat.fr Fri Feb 19 12:00:08 1993 Relayed; Fri, 19 Feb 1993 12:00:06 +0100 Fri, 19 Feb 1993 12:00:07 +0100 Fri, 19 Feb 1993 11:59:34 +0100 Fri, 19 Feb 1993 13:00:05 +0100 Date: Fri, 19 Feb 1993 13:00:05 +0100 From: Bosc Patrick Subject: Re: "Who is Who in Fuzzy-Mail" Dear Colleague, It is my pleasure to send you my contribution to the Who's who. Patrick BOSC (IRISA/ENSSAT, 6 rue de Kerampont, BP 447, 22305 Lannion Cedex, France) is interested in - fuzzyness, imprecision and uncertainty in database systems, - flexible querying using fuzzy predicates, weakening mechanisms, ... - fuzzy aggregation operators, - fuzzy constraints in databases Best regards, Prof. Patrick BOSC From takagi@diva.Berkeley.EDU Fri Feb 19 21:34:23 1993 Date: Fri, 19 Feb 93 12:34:21 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: Call for Help from Erik Erik Horstkotte of Togai InfraLogic, Inc. asked me to forward the attachd Call-for-Help through fuzzy mailing lists. Hideyuki TAKAGI -------------------- forwarded message -------------------------- Greetings, all. As part of putting together a proposed FAQ (frequently-asked questions list) for the USENET newsgroup comp.ai.fuzzy, I'd like to be able to include contact information for various organizations. The problem is that I've had a bad time trying to get any information, especially about the professional organizations. This is a call for help! I'm looking for any contact information (snail mail, telephone, and all forms of electronic mail) for *any* organizations you can think of that are related to fuzzy logic and fuzzy expert systems. In particular, I'd like information for companies that supply fuzzy products (Omron, Aptronix, etc.), and the professional organizations (NAFIPS, IFSA, etc.). I'd really like some help on companies and organizations outside the USA, too - they're the hardest for me to get any information on. In fact, the hardest piece of information to find for me has been where to get copies of the conference proceedings published by the various professional organizations. No one seems to know. Please reply by email (to erik@til.com), the results will become part of the proposed comp.ai.fuzzy FAQ which I will post (I hope, I hope) quite soon. -- Erik Horstkotte, Togai InfraLogic, Inc. The World's Source for Fuzzy Logic Solutions (The company, not me!) erik@til.com, gordius!til!erik - (714) 975-8522 info@til.com for info, fuzzy-server@til.com for fuzzy mail-server ------------------- end of forwarded message ----------------------- From RFULLER@finabo.abo.fi Mon Feb 22 07:53:16 1993 <01GV0MU5VQ68AJN264@finabo.abo.fi>; Mon, 22 Feb 1993 09:23:57 EET Date: 22 Feb 1993 09:23:56 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Further progress in Who is Who in Fuzzy Mime-Version: 1.0 Dear Colleagues, Last week I received ten more records from you for "whoiswhoinfuzzy" file. It contains now 28 records, which is still only about 20% of the total number of participants of Fuzzy-Mail. Please keep me sending your record! Enclosed you can find the recent "whoiswhoinfuzzy" file. With best wishes. Robert Fuller. bye bye Archive LISTSERV: file whoiswhoinfuzzy, part 1/1, size 10000 bytes: ------------------------------ Cut here ------------------------------ "Who is Who in Fuzzy": this file can be obtained by sending the command "get listserv whoiswhoinfuzzy" to listserv@vexpert.dbai.tuwien.ac.at All updates and changes should be mailed, preferably in the format of other entries of this file, to the administrator of this file, Robert Fuller, e-mail: rfuller@finabo.abo.fi Last update: 930221 ---------------------------------------------------------------------- Andrea Bonarini Politecnico di Milano Artificial Intelligence and Robotics Project, Dipartimento di Elettronica e Informazione, Politecnico di Milano, Piazza Leonardo da Vinci, 32, I-20133 Milano, Italy, Phone +39 2 2399 3525, Fax +39 2 2399 3587 E-mail: bonarini@ipmel2.elet.polimi.it, is interested in - automatic learning of fuzzy rulebases by using evolutionary approaches (Genetic Algorithms, ...) (main application: mobile robots) - integration of fuzzy and traditional control systems (application: robotics) - fuzzy simulation (application: industrial plants, robotics) - uncertainty management (application: multi-model based diagnosis of industrial plants, car driver modeling, DSS) ---------------------------------------------------------------------- ---------------------------------------------------------------------- Patrick BOSC IRISA/ENSSAT, 6 rue de Kerampont, BP 447, 22305 Lannion Cedex, France, is interested in - fuzzyness, imprecision and uncertainty in database systems, - flexible querying using fuzzy predicates, weakening mechanisms, ... - fuzzy aggregation operators, - fuzzy constraints in databases ---------------------------------------------------------------------- ---------------------------------------------------------------------- Peter Cheung Department of Electrical & Electronic Engineering, Imperial College of Science and Technology, University of London, London, SW7 2BT. email: p.cheung@ic.ac.uk tel: +44-71-589-5111 x 5226 fax: +44-71-823-8125 Interests: - fuzzy reasoning for electronic designs - fuzzy logic for hand-writing recognition - fuzzy logic hardware architecture - learning in fuzzy logic ---------------------------------------------------------------------- ---------------------------------------------------------------------- Patrik Eklund Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654684, fax: 358-21-654732, e-mail: peklund@finabo.abo.fi is interested in - Neural fuzzy systems - Fuzzy logic programming - Fuzzy clustering - Process control - Medical diagnostic - Foundations of fuzzy sets - Fuzzy convergence ---------------------------------------------------------------------- ---------------------------------------------------------------------- Wolfgang Eppler Research Centre for Computer Science, FZI, Haid- und Neustr. 10-14, D-7500 Karlsruhe, Germany, phone: +49-721-9654-449, fax: +49-721-9654-459, e-mail: eppler@fzi.de is interested in - neural fuzzy control - fuzzy control applications - model-based neural controllers - representation of (fuzzy) symbols in neural networks Remarks: Working in this domain since 1989 ---------------------------------------------------------------------- ---------------------------------------------------------------------- Janos C.Fodor Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Budapest, phone: 36-1-1869066, fax: 36-1-1811-976, e-mail: h1367fod@huella.bitnet is active in the following topics: - operations on fuzzy sets, (basic theoretical questions of t-norms, weak t-norms and fuzzy implications) - fuzzy relations, (axiomatic approach to fuzzy preference modeling; different kinds of orders; traces of fuzzy binary relations) - using fuzzy preference modeling in multicriteria decision making problems, (aggregation of preferences, comparison of pre- and post-choice methods; ranking by scoring; consensus via aggregation of decomposable measures) ---------------------------------------------------------------------- ---------------------------------------------------------------------- Robert Fuller Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-811-976) is interested in - using fuzzy reasoning techniques for solving fuzzy mathematical programming problems, - linear and nonlinear systems with fuzzy numbers, t-norm-based-operations on fuzzy sets, - fuzzy control, - neuro-fuzzy techniques for medical diagnostics Remark: The actual address for correspondence is Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654754, fax: 358-21-654732, e-mail: rfuller@finabo.abo.fi. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Antonio Gonzalez Dpto. Ciencias de la Computacion e Inteligencia Artificial Universidad de Granada 18071-Granada (Spain) Phone: +34.58.243199, Fax: +34.58.243317 email: agonzalez@ugr.es, gonzalez@robinson.ugr.es Areas of research: -Automatic learning in a fuzzy environment -Approximate reasoning -Uncertainty management -Fuzzy control ---------------------------------------------------------------------- ---------------------------------------------------------------------- Jan Jantzen Technical University of Denmark, Electric Power Eng. Dept., building 325, DK-2800 Lyngby, DENMARK, Ph: (+45) 4288 1633, Fax:(+45) 4288 6111 is interested in - fuzzy control: Rule based, table based, self-organising, fuzzy PID, stability, tuning; MATLAB, SIMULINK, C - image processing: object recognition in magneto-resonance images of the human brain, rule based; MATLAB, C - fuzzy logic: array based inference, truth tables, inner / outer products, transitivity; APL, BEOLOGIC ---------------------------------------------------------------------- ---------------------------------------------------------------------- Tibor Keresztfalvi Department of Applied Analysis, Eotvos Lorand University, Muzeum korut 6-8, H-1088 Budapest, Hungary, e-mail: xtibor@ludens.elte.hu investigates - t-norm-based operations on fuzzy intervals, - extended functions (defined via a sup-t-norm convolution), - fuzzy (multiobjective) mathematical programming problems under t-norms, - exact calculation formulas in fuzzy logic. Remark: Recent address: Institut fur Statistik and Mathematik, University of Frankfurt, Mertonstrasse 17-25, W-6000 Frankfurt am Main, fax: 49-69-7983330, e-mail: keresztfalvi@wiwi.uni-frankfurt.dbp.de. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Laszlo T. Koczy Department of Telecommunication and Telematics, Technical University of Budapest, Fax: +361-1812-302 or +361-1666-808, h1256koc@ella.hu or h1256@huella.bitnet is active in the fields - algorithms of fuzzy rule based control (complexity, interpolation, extrapolation, general approximation of rules) - certain aspects of computer vision by fuzzy methods (edge detection, components positions, etc.) - fuzzy hardware components (flip-flops, various circuits) - fuzzy graphs - properties of strictly monotonous norms and corresponding algebraic structures Remarks: Started fuzzy research in 1973. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Margit Kovacs Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-1811-976, e-mail: margo@cs.elte.hu is mainly interested in - theoretical foundation and comparison of fuzzy optimality concepts, multiobjective linear programming - stability properties of the solution of fuzzy optimization problems and searching for relationships between classical classical regularization methods and fuzzification - solution concepts of fuzzy linear systems and fuzzy linear model fitting - economical and technical applications of fuzzy theory - approximate reasoning for optimization ---------------------------------------------------------------------- ---------------------------------------------------------------------- Sonja Kowalewski University of Koblenz-Landau, Department of Computer Science, Institute of Computational Linguistics, Rheinau 3-4, W-5400 Koblenz, Germany, Phone: +49-261-9119-468, Fax: +49-261-37524, email: kowa@infko.uni-koblenz.de is interested in - fuzzy logic in natural language processing, especially in generating natural language texts (modelling vagueness, ambiguity and acceptability) - fuzzy logic in knowledge representation ---------------------------------------------------------------------- ---------------------------------------------------------------------- Mikko LIPSANEN, Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654538, fax: 358-21-654732, Research Interests: - Means to represent uncertain information in decision support systems especially Causal Probabilistic Networks. - Model based systems in medical decision making. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Ashutosh Malaviya GMD-FUZZY, German National Research Center for Comp. Sc. Postfach 1316 Tel: +49-2241-14-2751 W-5205 St.Aogustin 1 Fax: +49-2241-14-2342 GERMANY e-mail: malaviya@borneo.gmd.de is presently working on - Online/Offline handwriting recognition using Fuzzy Logic ( Mathematical formula recognition with PenTop and document recognition/analysis ) - Fuzzy Pattern Recognition/ Computer Vision and his research interests include - fuzzy grammars, fuzzy kohonen maps, fuzzy-GA/NNs - Applying Fuzzy Logic in Pattern Recognition and Control Systems - VLSI realization of Fuzzy Solutions ---------------------------------------------------------------------- ---------------------------------------------------------------------- Wolfgang Naether Department of Mathematics Technical University Mining Academy Freiberg D-O-9200 Freiberg Bernhard-von-Cotta-Str. 2 phone: +49-3731-51-2689 fax: +49-3731-51-3442 e-mail: naether@mathe.ba-freiberg.dbp.de is interested in - fuzzy statistics - fuzzy data analysis - fuzzy measures - non-probabilistic inference ---------------------------------------------------------------------- ---------------------------------------------------------------------- Mikio Nakatsuyama Department of Electronic Engineering, Yamagata University, 992 Japan, Phone: +81-238-22-5181 EXT 329, Fax: +81-238-24-2752) is interested in - neuro-fuzzy control - fuzzy C - neuro-fuzzy expert systems - fuzzy image processing Remark: Address Department of Electronic Engineering, Yamagata University, 4-3-16 Jonan, Yonezawa 992 Japan Phone: +81-238-22-5181 EXT 329, Fax: +81-238-24-2752 E-mail: nakatsu@ea5.yz.yamagata-u.ac.jp ---------------------------------------------------------------------- ---------------------------------------------------------------------- Detlef Nauck Technical University of Braunschweig, Department of Computer Science, Bueltenweg 74 - 75, W-3300 Braunschweig, Germany, Tel: +49.531.391.3155, Fax: +49.531.391.5936, email: nauck@ibr.cs.tu-bs.de is interested in - fuzzy control - combinations of neural networks and fuzzy systems, i.e. any kind of neuro-fuzzy approach ---------------------------------------------------------------------- ---------------------------------------------------------------------- VESA A NISKANEN DEPT. OF ECONOMICS & MANAGEMENT, P.O. BOX 27 (VIIKKI, A-HOUSE), SF-00014 UNIVERSITY OF HELSINKI, FINLAND, Phone: +358 0 708 5052, Fax: +358 0 708 5096 E-mail: niskanen@cc.helsinki.fi is interested in - METHODOLOGICAL PROBLEMS OF FUZZY SYSTEMS - FUZZY REASONING - FUZZY DECISION-MAKING - EDUCATION OF FUZZINESS - FUZZY NEURAL NETS - FUZZY STATISTICS ---------------------------------------------------------------------- ---------------------------------------------------------------------- Da RUAN Nuclear Research Centre SCK/CEN Boeretang 200, B-2400 Mol, Belgium tel. +32-14-332272 fax. +32-14-315021 e-mail: br1stag2 at bmlsck11 is interested in: -fuzzy expert system development (fuzzy implication operators and rule base, fuzzy inference rules) -fuzzy simulation, classification and decision making (nuclear reactor, decision aiding systems) -fuzzy systems in nuclear science and engineering -general use of fuzzy logic and intelligent technologies in application domains. ---------------------------------------------------------------------- ---------------------------------------------------------------------- Tony Riissanen Department of Computer Science, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654755, fax: 358-21-654732, e-mail: triissanen@finabo.abo.fi is interested in - Fuzzy control - Fuzzy clustering - Neural fuzzy nets - Fuzzy pattern recognition ---------------------------------------------------------------------- ---------------------------------------------------------------------- Wolfgang SLANY Christian Doppler Labor fuer Expertensysteme Abteilung fuer Datenbanken und Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria Tel: +43-1-58801-6123 FAX: +43-1-5055304 email: wsi@vexpert.dbai.tuwien.ac.at is interested in - Fuzzy Constraint Satisfaction Problems and Fuzzy Constraint Relaxation - Fuzzy Scheduling, Knowledge-Based Scheduling, Reactive Scheduling - Industrial Applications of Fuzzy Logic - Advanced User Interfaces - cooperating in ESPRIT IV projects He is the administrator of the European fuzzy-mail list: ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send "subscribe fuzzy-mail Your Real Name" as a message to | | listserv@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like "help" to listserv@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ ---------------------------------------------------------------------- ---------------------------------------------------------------------- Klaus Stohl VOEST-ALPINE Industrieanlagenbau GmbH, Dept. TAP1, Turmstr. 44, 4031 Linz, Austria, phone: +43 732 592 3631, fax: +43 732 592 2089, e-mail: stohl@vai.co.at is interested in: - building large applications (automation in the steel industry), large means, many inputs, many outputs, long inference chains - fuzzy expert systems - combining fuzzy logic and neural networks ---------------------------------------------------------------------- ---------------------------------------------------------------------- Robert VALETTE LAAS-CNRS, 7 Av. du Colonel Roche, F-31077 TOULOUSE Cedex France, TEL:++33 61336409, FAX:++33 61553577, NET: robert@laas.fr is interested in - using fuzzy reasoning techniques for controlling and monitoring Manufacturing Systems - using fuzzy reasoning on processes (fuzzy date, fuzzy state...) - fuzzy Petri nets, ---------------------------------------------------------------------- ---------------------------------------------------------------------- Prof. J.L. Verdegay Dept. of Computer Science and Artificial Intelligence University of Granada 18071 Granada (Spain) Phone: +34.58.244018, Fax: +34.58.243317, email: jverdegay@ugr.es Areas of research: Fuzzy logic in optimization problems Genetic Algorithms Fuzzy control Approximate Reasoning Decision support systems ---------------------------------------------------------------------- ---------------------------------------------------------------------- Harry Virtanen Department of Computer Science, Abo Akademi University Lemminkainengatan 14 A, SF-20520 Abo, Finland Tel: +358-21-654 541, Fax: +358-21-654 732 e-mail: hvirtanen@finabo.abo.fi is interested in - Fuzzy logic programming - Fuzzy Expert Systems - Neuro fuzzy systems - Fuzzy Control ---------------------------------------------------------------------- ---------------------------------------------------------------------- Bartel Van de Walle Nuclear Energy Research Center, Boeretang 200, B - 2400 MOL BELGIUM, and State University of Ghent, Applied Mathematics and Computer Science Departement, S9, Krijgslaan 281, 9000 GENT, BELGIUM, Phone +32 14 33 2813, e-mail: vdwalle at bmlsck11.bitnet is interested in: - decision support systems (esp. related to nuclear energy) - uncertainty in decision making - fuzzy data bases - nuclear energy related fuzzy research ------------------------------------------------------------------------ ------------------------------------------------------------------------ Roman Weissgaerber Institut fuer Computertechnik Technische Universitaet Wien Gusshausstrasse 27-29/384 A-1040 Vienna, Austria Phone: +43-1-58801-3824, Fax: +43-1-50538984 E-mail: roman@ece.tuwien.ac.at is interested in: - demonstration models of fuzzy control for educational purposes (simulations and real models e.g. small vehicles) - online and offline learning techniques for fuzzy control (Neural Networks, Genetic Algorithms, ...) - Intelligent Fuzzy Control (Fuzzy Controller with multiple levels of reasoning) - Fuzzy Hardware ------------------------------------------------------------------------ ------------------------------ Cut here -------------------------------- From @HUEARN.SZTAKI.HU:H1133Mar@huella.bitnet Mon Feb 22 09:32:14 1993 Mon, 22 Feb 93 10:06:47 SET gmt+1 Subject: research offer From: H1133Mar@huella.bitnet Date: 22 Feb 93 09:52:34 +0100 Dear Professor We, Andreja Tepavcevic and Branimir Seselja, are on the teaching staff at the institute of Mathematics, University of Novi Sad (our C.V's are included). For some time we have been working on the problems in the algebraic fuzzy set theory and its applications (some of our recent results have been published in FSS 52 and FSS 53). Our concept of a fuzzy set is based on lattices, and more generally, on relational systems. By this approach, we can deal with problems arising in the applications of fuzzy sets. The results appear to be more readily applicable than those obtained by "classical" fuzzy sets (roughly speaking, the difference between relational valued and "classical" fuzzy sets is comparable to the one between colour and b/w picture). In particular, our interests lie in the coding theory, pattern recognition, information sciences etc. The situation in our country prevents us from using appropriate equipment and maintaining necessary contacts with collegues and institutions outside Yugoslavia. Therefore, we would be happy to accept professional work for a period of time at any institution interested in applications and use of the fuzzy set theory, and one which would provide the framework for intensive research. If there is such a possibility at your Institute, or if you know the one to which you can transfer this message, please let us know. However, we must ask you to use the E-mail of professor L.Marki in Budapest, noting that the message is for B.Seselja. Yours sincerely Andreja Tepavcevic Branimir Seselja BRANIMIR SESELJA C.V. Born: 1948 Sex: male Nationality: Yugoslav (croat extraction) Languages: Mother-tongue:Serbo-Croat, Fluent: English and French, Communicative competence in Russian Degrees: B.Sc.1972. Mathematics, M.Sc.1976. Mathematics-Algebra, Ph.D.1981. Mathematics-Algebra Employment: 1973-76 Faculty of Technology, University of Novi Sad 1976- Institute of Mathematics, University of N.S. Position: Full Professor Teaching assignments: lectures in: Theory of Lattices and Boolean algebras, Automata theory, Discrete Theory of Information, Mathematical Elements of Informatics, Introduction to Informatics, Mathematics for students of Agriculture. Supervising researches at the graduate programs in algebra. Fields of interest: Universal algebra, Lattice Theory, Fuzzy set Theory Professional output: c.50 scientific papers (published in Algebra Universalis, Studia Sci.Mat.Hung., General Algebra, Fuzzy Sets and Systems, etc.) and 10 textbooks in mathematics, including a translation from French to Serbo-Croat. Participated in many conferences on topics in Algebra and Fuzzy set Theory. Several invited lectures. Referee for Fuzzy Sets and Systems, reviewer for Mathemtical Reviews, reviewed papers for Discrete Applied Mathematics, Information Sciences and others. ANDREJA TEPAVCEVIC C.V. Born: 1964 Sex: female Nationality: Yugoslav (croat and serbian extraction) Languages: Mother-tongue:Serbo-Croat, Fluent: English, Communicative competence in Spanish and Russian Degrees: B.Sc.1987. Informatics, 1988. Mathematics M.Sc.1990. Mathematics-Algebra, Ph.D. in the process of completion Employment: 1988- Institute of Mathematics, University of N.S. Position: Assistent Lecturer Teaching assignments: practicals in: Mathematical Logic, Algebra, Universal algebra, Discrete Theory of Information, Mathematical Elements of Informatics, Introduction to Informatics, Mathematics for students of Agriculture and Technology. Fields of interest: Universal algebra, Lattice Theory, Fuzzy set Theory Professional output: c.20 scientific papers (published in General Algebra, Fuzzy Sets and Systems, etc.) Participated in several conferences in Universal Algebra and Lattice Theory. One invited lecture. From mouaddib@loria.fr Mon Feb 22 17:26:01 1993 (5.65c+/IDA-1.4.3 for fuzzy-mail@vexpert.dbai.tuwien.ac.at); Mon, 22 Feb 93 18:02:54 +0100 From: Noureddine Mouaddib Subject: Who is Who in Fuzzy-Mail Date: Mon, 22 Feb 93 18:02:53 MET Contribution to the Who is Who. ------------------------------- I'm interesting in : - Modeling and Analysis fuzziness, impreciseness and uncertainty in information & database systems, - Extension of relational algebra to fuzzy databases, - Definition of an object oriented environment to describe and manage fuzzy information. Best regards, Dr. Noureddine MOUADDIB Centre de Recherche en Informatique de Nancy CRIN URA-CNRS 262 BP 239 54506 Vandoeuvre-les-Nancy Cedex France Tel : (33) 83 59 20 63 Fax : (33) 83 41 30 79 email : mouaddib@loria.fr From mpatyra@uc.d.umn.edu Mon Feb 22 18:10:22 1993 Date: Mon, 22 Feb 93 12:02:09 CST From: mpatyra@uc.d.umn.edu (marek patyra) ******************************************************************************* Seminar Announcement! ******************************************************************************* "Fuzzy Logic VLSI Implementations and Applications" 9 - 11 June 1993 Swiss Federal Institute of Technology EPFL-Lausanne Switzerland Objective --------- This three-day seminar is the first part of 13-day course. The idea of this course is to provide participants with the necessary bekground covering fuzzy sets theory and fuzzy logic along with demonstrations of practical solutions. CMOS VLSI design and implementation as well as fuzzy system simulation will be presented in details. Outline Presenters ------- ---------- Introduction Prof. Henri Prade, Institute de Recherche en Informatique de Toulouse, France Applications of Fuzzy Logic Prof. Laszlo Koczy, Department of Industrial Engineering, Technical University of Budapest, Hungary CMOS VLSI Implementation Prof. Marek Patyra, Department of Computer Engineering, University of Minnesota, USA Fuzzy Systems Simulation Ing. Laurent Lemaitre, Department of Electrical Engineering, Swiss Federal Institute of Technology, Lausanne, Switzerland CMOS VLSI Fuzzy Circuits Design Ing. Olivier Landolt, Centre Suisse d'Electronique et de Microtechnique, SA Neuchatel, Switzerland !!! A SPECIAL GUEST PRESENTATION IS ALSO PLANNED !!! Who should attend ? ------------------- Electronic engineers, company decision makers, VLSI and ASIC designers, technicians, and university & high school students. Participants are free to attend part I (first three days Seminar), or part II (three weeks Workshop), or to combine part I and part II. Fees ---- Part I (three days) SFr. 800.- (Fees cover Notebooks, slide copies, program materials, break refreshments and lunches.) For more information contact Marek Patyra at (218) 726-6103 or through e-mail: mpatyra@uc.d.umn.edu. ******************************************************************************* ******************************************************************************* Workshop Announcement! ******************************************************************************* "Practical Problem Solving Using Fuzzy Technology" June 9 - 25, 1993 and September 20 - 24, 1993 Swiss Federal Institute of Technology EPFL-Lausanne Switzerland Objective --------- This four weeks course/workshop is an international course in cooperation with the Department of Computer Engineering, University of Minesota, USA. The idea of this course is to provide participants the necessary bakground covering the fuzzy sets theory and fuzzy logic (first week) along with demonstrations of practical solutions (second and third week). CMOS VLSI design and implementation as well as fuzzy system simulation will be presented. The second and third week are dedicated to the design of a Fuzzy logic based chip, which will be fabricated and tested in the fourth week (20 to 24 September 1993). Outline ------- Week I: Introduction to Fuzzy Logic Theory Week II: Project formulation and solving Week III: Project simulation and fuzzy ASIC chip design Week IV: Chip testing (after manufacturing) Who should attend ? ------------------- Electronic and computer engineers, company decision makers, VLSI and ASIC designers, university & high school students. Participants are free to attend the part I (first three days), or part II (three weeks), or to combine part I and part II of the Seminar/Workshop. Fees ---- Three days (part I) SFr. 800.- Four weeks (part II) SFr. 4,500.-* Fees cover Notebooks, slide copies, program materials, break refreshments and lunches. In case of the Workshop organizers will help with accomodation in Lausanne. For more information contact Marek Patyra at (218) 726-6103 or through e-mail: mpatyra@uc.d.umn.edu. _________________________________________________ *This price includes the chip manufacturing cost. ******************************************************************************* From wsi@altair Wed Feb 24 12:51:37 1993 Date: Wed, 24 Feb 93 12:50:15 +0100 From: wsi@altair (Wolfgang Slany) Subject: Re: Wolfgang Slany is in Japan until February 22, 1993 + whoiswhoinfuzzy [] Sorry for this vacation junk-mail message that slipped into the distribution channel of fuzzy-mail. I changed yesterday the configuration in order to avoid such messages in the future. [] Please send all statements to be included in the File whoiswhoinfuzzy DIRECTLY to Robert Fuller, e-mail: rfuller@finabo.abo.fi (please do not send them to fuzzy-mail). For details send the "information fuzzy-mail" command to listserv@vexpert.dbai.tuwien.ac.at (please do not send it to fuzzy-mail). Sorry for the inconvenience caused. Best Regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 From Mail_System@VAXA.MIDDLESEX.AC.UK Wed Feb 24 13:23:18 1993 Via: uk.ac.middlesex.vaxa; Wed, 24 Feb 1993 12:17:13 +0000 Date: Wed, 24 Feb 93 12:08 GMT From: Mail_System@VAXA.MIDDLESEX.AC.UK Subject: %% Undelivered Mail %% Your mail was not delivered as follows: POSTMASTER not authorised to relay this message Your original mail header and message follow. %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% Via: UK.AC.NSFNET-RELAY; Wed, 24 Feb 93 12:08 GMT id ; Wed, 24 Feb 1993 11:55:20 +0000 id AA22042; Wed, 24 Feb 93 12:54:43 +0100 id AA16192; Wed, 24 Feb 93 12:54:34 +0100 Date: Wed, 24 Feb 93 12:54:33 +0100 Original-Sender: fuzzy-mail@at.ac.tuwien.dbai.vexpert From: wsi@at.ac.tuwien.dbai.vexpert (Wolfgang Slany) Subject: Re: Wolfgang Slany is in Japan until February 22, 1993 + whoiswhoinfuzzy [] Sorry for this vacation junk-mail message that slipped into the distribution channel of fuzzy-mail. I changed yesterday the configuration in order to avoid such messages in the future. [] Please send all statements to be included in the File whoiswhoinfuzzy DIRECTLY to Robert Fuller, e-mail: rfuller@finabo.abo.fi (please do not send them to fuzzy-mail). For details send the "information fuzzy-mail" command to listserv@vexpert.dbai.tuwien.ac.at (please do not send it to fuzzy-mail). Sorry for the inconvenience caused. Best Regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% End of returned mail From weisbrod@karlsruhe.gmd.de Mon Mar 1 08:02:40 1993 From: Joachim Weisbrod Date: Mon, 1 Mar 93 08:02:33 +0100 help subscribe fuzzy-mail Joachim Weisbrod From til.com!vivian@til.com Mon Mar 1 15:55:28 1993 Date: Mon, 1 Mar 93 06:45:08 PST From: vivian@til.com (Vivian Tsou) Subject: Re: Thank you for your interest in Togai InfraLogic products and services. Contact TIL's distributor in Germany for sales information. To receive information about fuzzy electronically, please send e-mail to our mail server at fuzzy-server@til.com with subject: help. You will receive an e-mail from the server describing the information available. GTS Trautzl GmbH Gottlieb-Daimler-Str. 9 D-2358 Kaltenkirchen Germany tel: 0 41 91 87 11 fax: 0 41 91 88 665 Best Regards, Vivian -- Vivian Tsou Togai InfraLogic, Inc. (The World's Source for Fuzzy Logic Solutions) 5 Vanderbilt Irvine CA 92718 USA vivian@til.com, gordius!til!vivian, tel.(714)975-8522, fax(714)975-8524 info@til.com for info, fuzzy-server@til.com for fuzzy mail-server From cmc37@scm.teesside.ac.uk Tue Mar 2 21:06:58 1993 Relayed; Tue, 2 Mar 1993 21:53:08 +0100 Tue, 2 Mar 1993 21:54:09 +0100 Tue, 2 Mar 1993 21:53:51 +0100 Tue, 2 Mar 1993 21:51:40 +0100 Tue, 2 Mar 1993 21:55:27 +0100 Date: Tue, 2 Mar 1993 21:55:27 +0100 From: M Kallala Lecturer Subject: Re: Who is Who in Fuzzy-Mail Hello, My coordinates are: Moncef Kallala, BSc, MSc & PhD School of Computing & Mathematics University of Teesside Middlesbrough Cleveland TS1 3BA Voice: (+642) 342692 Fax.: (+642) 342691 E-mail: kallala@uk.ac.teesside.scm My interest are: *Fuzzy Relations, Fuzzy Implications in Medical Assessment and Diagnosis *Fuzzy Logic & Neural Nets in Control *Large Fuzzy Data Bases *Fuzzy Expert Systems *Fuzzy Logic in HCI and Hypermedia Regards, M Kallala From ricardo@iai.es Wed Mar 3 10:12:20 1993 Relayed; Wed, 3 Mar 1993 10:12:15 +0100 Wed, 3 Mar 1993 10:13:05 +0100 Wed, 3 Mar 1993 10:12:29 +0100 Wed, 3 Mar 1993 09:05:56 +0100 Date: Wed, 3 Mar 1993 09:05:56 +0100 Conversion: Prohibited From: RICARDO In-Reply-To: <28239.9303022055@scm.tees.ac.uk> Subject: Re: Who is Who in Fuzzy-Mail My coordinates are: Dr. Ricardo Garcia Rosa Instituto de Automatica Industrial, CSIC 23 Km de N3, La Poveda, Arganda del Rey 28500 Madrid, Spain phone 34 1 8711900 fax 34 1 8717050 e-mail ricardo@iai.es My interest related to fuzzy techniques are: - fuzzy control, - robotics. My expeience: - control of mobile robots, - multifinger robot and expert fuzzy system to automatic tunning of electronic equipement. Kind regards Ricardo From AGUILAR@EMDCCI11.BITNET Wed Mar 3 11:16:55 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 3731; Wed, 3 Mar 1993 11:16:42 +0100 BSMTP id 9323; Wed, 03 Mar 93 09:35:07 HOE Date: Wed, 03 Mar 93 09:31:43 HOE From: "Juan A. Aguilar-Crespo" Organization: Instituto de Ingenieria del Conocimiento, Madrid Subject: CALL FOR PAPERS IRTICS'93 CALL FOR PAPERS Workshop on Integration Technology for Real-Time Intelligent Control Systems October 5-7, 1993 Madrid, SPAIN Sponsored by: The Commission of the European Communities (CEC) The HINT project Organized by: Instituto de Ingenieria del Conocimiento (IIC) AIM: ---- Nowadays, the necessity of using together several techniques in order to improve the benefits of real-time intelligent control systems has become a constant in most industrial environments. Expert systems, neural networks, fuzzy logic, modelization, etc... can solve problems but, in many cases, a solution that partly involves different techniques leads to synergic effects. So, cooperation among different approaches has become a crucial area of interest in this environment, being the objective to get common frameworks where you can use the best of each technique as effectively as possible. This certainty moved us to the present workshop on "Integration for Real-Time Intelligent Control Systems", IRTICS'93, that we are sure will be a good opportunity of examining many of the possibilities that exist, or will exist, in this direction. This workshop aims to encourage the communication and exchange of ideas among researchers, practitioners and end-users aware of the possibilities of integrating different AI technologies in real-time environments. Contributions addressing both theoretical problems and practical experiences will be of great interest for this forum. The workshop is organized by the Instituto de Ingenieria del Conocimiento, IIC, as an external activity of the HINT project: heterogeneous integration architecture for intelligent control systems (ESPRIT 6447). All the correspondence about the workshop will be addressed to the Workshop Secretariat at the IIC. TOPICS: ------- Researchers and practitioners interested in the possibilities of /integration/ among different techniques applied to real-time environments, so as /specific works/ that could be synergically enforced by means of integration, are invited to participate in the workshop by submitting an extended abstract as specified. Suggested topics include Integration Techniques for: * Expert Systems * Neural Networks * Fuzzy Logic * Model Based Reasoning * AI Architectures * Intelligent User Support Systems SUBMISSION REQUIREMENTS: ------------------------ Authors should submit 3 copies of an extended abstract (max 2000 words, approximately 5 single spaced pages) to the secretariat of the workshop before the deadline indicated in the timetable. They should include separately a page containing their name and full address, e-mail, fax or telephone, and the section(s) their work is related to. All the contributions will be submitted in English. Abstracts will be reviewed according to their relation with the basic aim of the workshop, clarity and originality. Accepted papers will be included in a book to be published with the results and conclusions of the workshop. PROGRAMME: ---------- The programme of the workshop will include three different activities: * Invited Contributions * Communications * Discussions We plan to include invited contributions about some state-of-the-art themes that are of interest for all the participants. The rest of the time, parallel sessions will be held about each topic, including communications and long time for discussions. The last of these sessions will deal with 'integration' as the main topic of the workshop. Participants are invited to summarize the results of their work in this final session. TIMETABLE: ---------- * Submissions must be received: by March 26, 1993. * Notification of acceptance or rejection: by April 30, 1993. * Camera-Ready versions: before June 30, 1993. REGISTRATION FEES: ------------------ The registration fees include midday lunch during the workshop, a Welcome Party to be hold on Monday 4th evening and the proceedings of the workshop. Registration: 400 ECU ORGANIZATION COMMITTEE: ----------------------- Enrica Chiozza (IIC, Spain) Pilar Rodriguez-Marin (IIC, Spain) PROGRAM COMMITTEE: ------------------ Fontaine L. (Dassault Electronique, France) Rodr guez-Mar n P. (IIC, Spain) Almeida L. B. (INESC, Portugal) Sundin U. (INFOLOGICS, Sweden) De Pablo E. (Repsol Petroleo, S.A., Spain) Jimenez A. (UPM, Spain) SECRETARIAT: ------------ Enrica Chiozza Instituto de Ingenieria del Conocimiento UAM Canto Blanco Modulo C-XVI, P. 4 28049 Madrid SPAIN Fax: (34 1) 397 3972 Phone: (34 1) 397 8520 E-mail: CHIOZZA @ EMDCCI11.BITNET CHIOZZA @ iic.uam.es From mpatyra@uc.d.umn.edu Mon Mar 15 17:29:00 1993 Date: Mon, 15 Mar 93 10:28:41 CST From: mpatyra@uc.d.umn.edu (marek patyra) ******************************************************************************* ******************************************************************************* Extended Announcement! ******************************************************************************* "Fuzzy Logic VLSI Implementations and Applications" 9 - 11 June 1993 Swiss Federal Institute of Technology EPFL-Lausanne Switzerland Objective --------- This three-day seminar is the first part of 13-day course. The idea of this course is to provide participants with the necessary bekground covering fuzzy sets theory and fuzzy logic along with demonstrations of practical solutions. CMOS VLSI design and implementation as well as fuzzy system simulation will be presented in details. Course Outline and Presenters ############################################################################### Introduction Prof. Henri Prade, Institute de Recherche en Informatique de Toulouse, France BIOGRAPHICAL NOTE Henri Prade is a Directeur de Recherche at the French National Center for Scientific Research (CNRS) and works at the Institut de Recherche en Informatique de Toulouse (IRIT) located at the Universite Paul Sabatier in Toulouse. He has contributed extensively to fuzzy sets and possibility theory and their applications for more than 15 years. He is the author (with Didier Dubois) of two books and many papers on this topic, and in the related field of uncertainty management in AI systems. He has recently edited Readings in Fuzzy Sets for Intelligent Systems (with D. Dubois and R. Yager) gathering significant papers on fuzzy set methods and applications published between 1965 and 1991. PRESENTATION DESCRIPTION The course will focus more particularly on the basic principles underlying fuzzy sets and possibility theory, with a view to applications to control systems, decision support systems, advanced information systems and knowledge-based systems. Basic ideas will be emphasized and some illustrative examples provided. ############################################################################### Design of fuzzy digital circuits Prof. Laszlo Koczy, Department of Industrial Engineering, Technical University of Budapest, Hungary BIOGRAPHICAL NOTE Position: associate professor Degrees: M.Sc. in Electrical Engineering (Fuzzy Theory and Fuzzy Control), Ph.D. 1977 Fuzzy Theory and Applications, both from the Technical University of Budapest, C.Sc.Eng. 1989, Random and Fuzzy Graphs, Hung. Acad. of Science. Visiting Appointements: Dalian Maritime University, China, 1990 (teaching Fuzzy Theory and Applications) Dept. of Computer Science, Pohang Inst. of Science and Technology, Korea 1992 (teaching fuzzy) Research Interests: Fuzzy operations with a special stress on algebraic operations. Fuzzy graphs and the use in network analysis and optimization. Fuzzy digital circuits, flip-flops and learning networks. Fuzzy control, interpolation and extrapolation of rule bases, reduction of computational complexity. PRESENTATION DESCRIPTION The design of fuzzy digital circuits - Fuzzy operations with a stress on strictly monotonous connectives - Storing fuzzy information in fuzzy bits (fits). The importance in multistep fuzzy control. - The concept of fuzzy flip-flop (F3) - Min-max flip-flop. Algebraic F3 - Circuits constructed with F3 - The problems of realizing F3 - The analog anfd digital (continuous and discrete mode) approach. - Experience with the various type F3 built by Hosei University/ Techn. Universitu of Budapest. - Conclusions ############################################################################### CMOS VLSI Implementation Prof. Marek Patyra, Department of Computer Engineering, University of Minnesota, USA BIOGRAPHICAL NOTE J. Patyra is an Assistant Professor at the Department of Computer Engineering, University of Minnesota, Duluth, MN, USA. He received the M.S. and Ph.D. degrees from Warsaw University of Technology, Warsaw, Poland in 1978, and 1986 respectively. From 1978 to 1989 he worked as an Assistant Professor at the Institute of Electron Technology, Warsaw, Poland. >From 1989 to 1991 he was a Research Associate at the Department of Electrical and Computer Engineering, Carnegie Mellon University, Pittsburgh, PA where he worked techniques for circuit design for manufacturability. During the Summer 1992 he was a Visiting Professor at the Swiss Federal Institute of Technology, Lausanne, Switzerland. He published several papers on VLSI implementation of fuzzy logic circuits. His main research area concentrates on analog and digital VLSI implementation of fuzzy and neural systems. PRESENTATION DESCRIPTION 1) Digital Implementation of Fuzzy Logic Circuits -Background -Digital Implementation of MAX and MIN Operators -Digital Fuzzification -Digital Defuzzification -Fuzzy Model Building -Fuzzy Logic Based VLSI Processors -Fuzzy Logic Based VLSI Controllers 2) Analog Implementation of Fuzzy Logic Circuits A) Current Mode Circuits Principles. -Basic Concept of Current Mode Circuits -Current Mode Static Circuits - Basic Concept -Circuit Overview (Bounded Difference - Complement) -Current Mode Dynamic Circuits (Bounded Difference, MIN, MAX) -Fuzzy Logic VLSI Circuits in Current Mode B) Voltage Mode Circuits. -Operation of Voltage Mode Circuits. -Circuit Overview (Bounded Difference - Complement) -Fuzzy Logic VLSI Circuits in Voltage Mode ############################################################################### Fuzzy Systems Simulation Ing. Laurent Lemaitre, Department of Electrical Engineering, Swiss Federal Institute of Technology, Lausanne, Switzerland BIOGRAPHICAL NOTE L. Lemaitre obtained his MS degree in Electrical Engineering from the the Institut National Polytechnique de Grenoble, France. He is currently working toward his PhD degree in Electrical Engineering the Swiss Federal Institute of Technology His reaserch interests include design of CMOS fuzzy systems and multivalued logic theory. He is also interested in possibility and uncertainty theories. PRESENTATION DESCRIPTION 1) Fuzzy Logic Based Controllers - Analogic approach - Digital approach 2) FLC#1: a Case Study developed at the Swiss Federal Institute - Fuzzification - Inference engine - Defuzzification 3) Practical Applications studied at the C3i Lab - Autofocus - Pattern Recognition - Control of a Car In common with Prof Marek Patyra 1) SCOFIC: Silicun Compiler of Fuzzy Integrated Circuits - Mathematical models of fuzzy units - Automatic generation - HSPICE simulations and Logic simulations: comparisons 2) GDT tools and Layout Generators - Min and Max units - Center of Gravity ############################################################################## CMOS VLSI Fuzzy Circuits Design Ing. Olivier Landolt, Centre Suisse d'Electronique et de Microtechnique, SA Neuchatel, Switzerland BIOGRAPHICAL NOTE Oliver Landolt reveived his MS degree in Electrical Engineering from EPFL in January 1992; His diplome project was carried out at the Electronics Laboratory, and oriented towards the analog CMOS IC design. He has been working as a R&D Engineer at the Swiss Center for Electronics and Microtechnology, Inc. (CSEM SA) since March 1992. His main research topics include analog implementation of fuzzy logic circuits and Kohonen networks. Other activities include developing advanced applications using those two techniques. PRESENTATION DESCRIPTION 1) implementing massively parallel structures in analog VLSI: - crucial requirements (density, power consumption) - identification of the essential properties needed for the cells - opportunistic choice of easily implementable functions 2) qualitative study of a set of fuzzy rules: - basic properties expected from the "condition" part - properties of the conclusion part - combining several rules 3) easily implementable equivalent functions for the two parts of a rule: - distance computing circuits - center of gravity circuits 4) analog CMOS family of cells: - condition and conclusion cells - storage cells - modular building of fuzzy rules 5) rulebase configurations for practical applications: - application specific: arbitrary configuration - general purpose: matrix of rules 6) using the programmable rule matrix as a new component: - stand-alone possibilities - parallel or hierarchical structures - implementing stationary or dynamical systems ############################################################################### !!! A SPECIAL GUEST PRESENTATION IS ALSO PLANNED !!! ############################################################################### Who should attend ? ------------------- Electronic engineers, company decision makers, VLSI and ASIC designers, technicians, and university & high school students. Participants are free to attend part I (first three days Seminar), or part II (three weeks Workshop), or to combine part I and part II. Fees ---- Part I (three days) SFr. 800.- (Fee covers Notebooks, slide copies, program materials, break refreshments and lunches.) !!! Attention: Special discount for students 50%. !!! Organizers will help in finding the reasonable asccomodation in Lausanne. For more information contact: USA: Marek Patyra at (218) 726-6103 or through e-mail: mpatyra@uc.d.umn.edu EUROPE: Laurent Lemaitre at (41)-(21)-693-6978 or through e-mail: Laurent_Lemaitre@deqm.epfl.ch ******************************************************************************* ******************************************************************************* Workshop Announcement! UPDATED ******************************************************************************* "Practical Problem Solving Using Fuzzy Technology" June 9 - 25, 1993 and September 20 - 24, 1993 Swiss Federal Institute of Technology EPFL-Lausanne Switzerland Objective --------- This four weeks course/workshop is an international course in cooperation with the Department of Computer Engineering, University of Minesota, USA. The idea of this course is to provide participants the necessary bakground covering the fuzzy sets theory and fuzzy logic (first week) along with demonstrations of practical solutions (second and third week). CMOS VLSI design and implementation as well as fuzzy system simulation will be presented. The second and third week are dedicated to the design of a Fuzzy logic based chip, which will be fabricated and tested in the fourth week (20 to 24 September 1993). Attendants will de disigning their own chips according to the problems they intend to solve. Outline ------- Week I: Introduction to Fuzzy Logic Theory Week II: Project formulation and solving Week III: Project simulation and fuzzy ASIC chip design Week IV: Chip testing (after manufacturing) Who should attend ? ------------------- Electronic and computer engineers, company decision makers, VLSI and ASIC designers, university & high school students. Participants are free to attend the part I (first three days), or part II (three weeks), or to combine part I and part II of the Seminar/Workshop. Fees ---- Three days (part I) SFr. 800.- Four weeks (part II) SFr. 4,500.-* Fees cover Notebooks, slide copies, program materials, break refreshments and lunches. In case of the Workshop organizers will help with accomodation in Lausanne. For more information contact Marek Patyra at (218) 726-6103 or through e-mail: mpatyra@uc.d.umn.edu. _________________________________________________ *This price includes the chip manufacturing cost. ******************************************************************************* From vestli@ifr.ethz.ch Mon Mar 15 19:34:06 1993 Date: Mon, 15 Mar 93 19:33:42 +0100 From: Sjur Jonas Vestli Subject: MODRO Dear Manfred, I hope you got my telefax with a list of MODRO systems today. Please feel free to contact me with any questions or requests. Sjur From AREK@pz-oekosys.uni-kiel.dbp.de Tue Mar 16 13:25:29 1993 Relayed; Tue, 16 Mar 1993 13:25:11 +0100 Tue, 16 Mar 1993 13:26:20 +0100 Tue, 16 Mar 1993 13:25:45 +0100 Tue, 16 Mar 1993 13:23:14 +0100 Tue, 16 Mar 1993 09:53:22 +0100 Date: Tue, 16 Mar 1993 09:53:22 +0100 From: Arek Salski Subject: 2nd CFP Fuzzy Logic in Ecological Modelling Fuzzy Logic in Ecological Modelling Workshop, October 12-14,1993 Ecosystem Research Center, University of Kiel, Germany - First Announcement and Call for Papers - In many fields of ecological research ecologists have to work with both objective and subjective information. Fuzzy logic lets them combine numerical data and linguistic statements in a unified manner. A fuzzy logic approach allows to deal with some uncertainty problems in ecological research, namely uncertainty of ecological data and uncertainty of expert knowledge. The purpose of this workshop is to present and to discuss state-of-the-art applications of fuzzy logic in the field of ecology. Topics of the workshop All aspects of fuzzy logic related to ecological research, and particulary applications of fuzzy logic to: - Qualitative Modelling - Approximate Reasoning Methods - Knowledge Representation - Expert Systems - Clustering - Databases in ecology. Participation The number of participants is limited to 30. Priority will be given to participants presenting papers. The workshop participation will be free of charge. Submission of abstracts Abstracts of paper (1-2 pages) should be sent to Dr. A. Salski not later than March 31, 1993. Reports on work in progress are welcome. Proceedings The organizers anticipate the publication of reviewed papers in a special issue of "Ecological Modelling" (Elsevier) 8-12 months after the workshop. A booklet of abstracts will be available at the workshop. Important Dates Registration and submission of abstracts...........April 30, 1993 Notification of acceptance ........................May 31, 1993 Submission of papers ..............................at the workshop Contact Address: Dr. A. Salski Projektzentrum Oekosystemforschung Universitaet Kiel Schauenburgerstr. 112 D-2300 KIEL, Germany Fax: ++49-431-880 40 83 E-Mail (Internet): arek@pz-oekosys.uni-kiel.dbp.de -- arek@pz-oekosys.uni-kiel.dbp.de Projektzentrum Oekosystemforschung Schauenburger Str. 112 * D-2300 Kiel 1 From AREK@pz-oekosys.uni-kiel.dbp.de Wed Mar 17 18:25:42 1993 Relayed; Wed, 17 Mar 1993 18:25:40 +0100 Wed, 17 Mar 1993 18:26:40 +0100 Wed, 17 Mar 1993 18:26:16 +0100 Wed, 17 Mar 1993 18:23:37 +0100 Wed, 17 Mar 1993 16:06:25 +0100 Date: Wed, 17 Mar 1993 16:06:25 +0100 From: Arek Salski Subject: Correction to 2nd CFP Fuzzy Logic in Ecological Modelling Correction to 2nd CFP Fuzzy Logic in Ecological Modelling Submission of abstracts Should be: Abstracts of paper (one page) should be sent to Dr. A. Salski not later than April 30, 1993. I apologize for the typing error in the original message. Arkadiusz Salski -- arek@pz-oekosys.uni-kiel.dbp.de Projektzentrum Oekosystemforschung Schauenburger Str. 112 * D-2300 Kiel 1 From langari@arya.tamu.edu Thu Mar 18 20:31:38 1993 (5.65b/IDA-1.4.3 for fuzzy-mail@vexpert.dbai.tuwien.ac.at); Thu, 18 Mar 93 13:30:50 -0600 Date: Thu, 18 Mar 93 13:33:40 CST From: langari@arya.tamu.edu (Reza Langari) help subscribe fuzzy-mail Reza Langari From takagi@diva.Berkeley.EDU Fri Mar 19 19:50:17 1993 Date: Fri, 19 Mar 93 10:50:15 -0800 From: takagi@diva.berkeley.edu (Hideyuki Takagi) Subject: NOLTA'93 The Call for Papers of NOLTA'93 came from connectionist mailing list. Hideyuki TAKAGI ----------------------------------------------------------------- Call for Papers 1993 International Symposium on Nonlinear Theory and its Applications Sheraton Waikiki Hotel, HAWAII December 5 - 9, 1993 The 1993 International Symposium on Nonlinear Theory and its Applications (NOLTA'93) will be held at the Sheraton Waikiki Hotel, Hawaii, on Dec. 5 - 9, 1993. The conference is open to all the world. Papers describing original work in all aspects of Nonlinear Theory and its Applications are invited. Possible topics include, but are not limited to the following: Circuits and Systems Neural Networks Chaos Dynamics Cellular Neural Networks Fractals Bifurcation Biocybernetics Soliton Oscillations Reactive Phenomena Fuzzy Numerical Methods Pattern Generation Information Dynamics Self-Validating Numerics Time Series Analysis Chua's Circuits Chemistry and Physics Mechanics Fluid Mechanics Acoustics Control Optics Circuit Simulation Communication Economics Digital/analog VLSI circuits Image Processing Power Electronics Power Systems Other Related Areas Organizers: Research Society of Nonlinear Theory and its Applications, IEICE Dept. of Elect. Engr., Univ. of Hawaii In cooperation with: IEEE Hawaii Section IEEE Circuits and Systems Society IEEE Neural Networks Council International Neural Network Society IEEE CAS Technical Committee on Nonlinear Circuits and Systems Technical Group of Nonlinear Problems, IEICE Technical Group of Circuits and Systems, IEICE Authors are invited to submit three copies of a summary of 2 or 3 pages to: Technical Program Chairman Prof. Shun-ichi Amari Faculty of Engr., University of Tokyo, Bunkyo-ku, Tokyo, 113 Japan Telefax: +81-3-5689-5752 e-mail: amari@sat.t.u-tokyo.ac.jp The summary should include the author's name(s), affiliation(s) and complete return address(es). The authors should also indicate one or more of the above categories that best describe the topic of the paper. Deadline for submission of summaries: August 15, 1993 Notification of acceptance: Before September 15, 1993 Deadline for camera-ready manuscripts: November 1, 1993 HONORARY CHAIRMEN Kazuo Horiuchi (Waseda Univ.) Masao Iri (Univ. of Tokyo) CO-CHAIRMEN Shun-ichi Amari (Univ. of Tokyo) Anthony Kuh (Univ. of Hawaii) Shinsaku Mori (Keio Univ.) TECHNICAL PROGRAM CHAIRMAN Shun-ichi Amari (Univ. of Tokyo) PUBLICITY Shinsaku Mori (Keio Univ.) LOCAL ARRANGEMENT Anthony Kuh (Dept. of Electrical Engr., Univ. of Hawaii, Manoa, Honolulu, Hawaii, 96822 U.S.A. Phone: +1-808-956-7527 Telefax. +1-808-956-3427 e-mail: kuh@wiliki.eng.hawaii.edu) ADVISORY L. O. Chua (U.C.Berkeley) R. Eberhart (Research Triangle Inst.) A. Fettweis (Ruhr Univ.) L. Fortuna (Univ. of Catania) W.J. Freeman (U.C.Berkeley) M. Hasler (Swiss Fed. Inst. of Tech. Lausanne) Tatsuo Higuchi (Tohoku Univ.) Kazumasa Hirai (Kobe Univ.) Ryogo Hirota (Waseda Univ.) E.S. Kuh (U.C.Berkeley) Hiroshi Kawakami (Tokushima Univ.) Tosiro Koga (Kyushu Univ.) Tohru Kohda (Kyushu Univ.) Masami Kuramitsu(Kyoto Univ.) R.W. Liu (Univ. of Notre Dame) Tadashi Matsumoto (Fukui Univ.) A.I. Mees (Univ. of Western Australia ) Michitada Morisue (Saitama Univ.) Tomomasa Nagashima (Muroran Inst. Tech.) Tetsuo Nishi (Kyushu Univ.) J.A. Nossek (Technical University Munich) Kohshi Okumura (Kyoto Univ.) T. Roska (Hungarian Academy of Sciences) Junkichi Satsuma (Univ. of Tokyo) I.W. Sandberg (Univ. of Texas at Austin) Chikara Sato (Keio Univ.) Yasuji Sawada (Tohoku Univ.) V.V. Shakhgildian (Russian Engr. Academy) Yoshisuke Ueda (Kyoto Univ.) Akio Ushida (Tokushima Univ.) J. Vandewalle (Catholic Univ. of Leuven, Heverlee) P. Werbos (National Science Foundation) A.N. Willson, Jr (U.C.L.A.) Shuji Yoshizawa (Univ. of Tokyo) A.H.Zemanian (State Univ. of NY at Stony Brook) SECRETARIATS Shin'ichi Oishi (Waseda Univ.) Mamoru Tanaka (Sophia Univ.) INFORMATION CONTACT Mamoru Tanaka Dept. of Electrical and Electronics Eng., Sophia Univ. Kioicho 7-1, Chiyoda-ku, Tokyo 102 JAPAN Fax: +81-3-3238-3321 e-mail: tanaka@mamoru.ee.sophia.ac.jp From wsi@altair Thu Mar 25 14:17:54 1993 Date: Thu, 25 Mar 93 14:27:00 +0100 From: wsi@altair (Wolfgang Slany) Subject: Call for Participation FLAI'93, June 28-30, 1993 This mail contains for your information * an invitation program for the forthcoming FLAI'93 conference "FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE" * registration material for FLAI'93 * how to attend the PhD workshop organized during FLAI'93 * how to subscribe and use the European fuzzy-mail list * how to attend the workshop on fuzzy logic in commercial and industrial applications during FLAI'93 * how to attend the workshop on Karl Menger, Fuzzy Logic and Artificial Intelligence - An Experiment in Reflection during FLAI'93 * how to attend the workshop on fuzzy scheduling during FLAI'93 * the contents of the tutorials organized during FLAI'93 * how to apply for an ECCAI travel award to attend FLAI'93 ------------------------------------------------------------------------- Eight Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Call for Participation and Registration Form General Information Flai'93 will be a forum for presentation of new results in research, development and applications of Fuzzy Logic in Artificial Intelligence. The conference will favor the sharing of information between researchers and practitioners, and outline future developments of Fuzzy Logic applications in Artificial Intelligence. The conference will take place in a cozy, seminar-like atmosphere on a hill overlooking Linz. The conference language will be English for the Scientific Program and the Workshops, the Tutorials will be given in German. Program Workshops June 28, 1993 * Workshop for Doctoral Students in Fuzzy-Based Systems * Fuzzy Logic for Commercial and Industrial Applications (English/German) / Fuzzy Logic fuer Wirtschaft und Industrie (Deutsch/Englisch) * Karl Menger, Fuzzy Logic and Artificial Intelligence - An Experiment in Reflection * Fuzzy Scheduling Systems Detailed information on the workshops follows. Persons wishing to attend a workshop must register to the technical program of FLAI'93 and contact the workshop organizers. Paper contributions are welcome, please send them directly to one of the corresponding workshop organizers. Tutorials June 28, 1993 (auf Deutsch / in German) * Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH Aachen * Nachmittag: Fuzzy Control - Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig Genaue Informationen zu den Tutorials folgen. Scientific Program June 29-30, 1993 Invited Talks: * Soft Computing, Lotfi A. Zadeh, University of California, Berkeley * Contextual Approach for AI Systems Development, Irina Ezhkova, Russian Academy of Sciences, Moscow Regular Paper Sessions: * Neural Networks, Genetic Algorithms, other learning paradigms, and Fuzzy Logic * Expert Systems and Fuzzy Logic * Robotics, Control, and Fuzzy Logic * Medicine and Fuzzy Logic * Driving with Fuzzy Logic * Theoretical Issues Panels and Special Sessions: * Panel 1: FL&AI: differences and meeting points. * Panel 2: A critical view on what is going on in Fuzzy Logic and Artificial Intelligence: Hit, Hype or both? * Workshop overview session. * ESPRIT Session: The session will present the EC view on the structure and content of Fuzzy Logic or Artificial Intelligence-related projects recently accepted in the ESPRIT program. Persons interested in participating in panels or other special sessions should contact the conference chairpersons. Details on the scientific program will be sent out to you before the conference. Exhibitions June 28-30, 1993 * There will be an exhibition on recent books relevant to the conference's theme "Fuzzy Logic in Artificial Intelligence". Suggestions for books to be exhibited are welcome. * Another exhibition will display Fuzzy Logic and Artificial Intelligence related hard- and software. Companies or individuals wishing to participate should contact the organizers. Conference Organizer Oesterreichische Gesellschaft fuer Artificial Intelligence / Austrian Society for Artificial Intelligence Conference Chairpersons Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 Wolfgang Slany Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6123 Fax: +43-1-5055304 Program Committee K.-P. Adlassnig (Austria) D. Dubois (France) M. Fedrizzi (Italy) A. Geyer-Schulz (Austria/Germany) V. H. Haase (Austria) R. Kruse (Germany) R. Lopez de Mantaras (Spain) M. Reinfrank (Germany) Ph. Smets (Belgium) H. Takagi (Japan/USA) R. R. Yager (USA) M. Zemankova (USA) H.-J. Zimmermann (Germany) Workshop Organizers Rainer Born (Johannes Kepler Universitaet Linz) Johann Gamper (Universitaet Wien), Andreas Geyer-Schulz (Wirtschaftsuniversitaet Wien / Universitaet Augsburg) Roger Kerr (Technische Universitaet Wien / University of New South Wales) Peter Kotauczek (BEKO GesmbH., Wien) Bernhard Moser (Universitat Salzburg) Cooperating Institutions Fuzzy Logic Laboratorium Linz Christian Doppler Labor fuer Expertensysteme Supporting Companies and Institutions BEKO - Ing. P. Kotauczek GesmbH., Wien Technologie und Marketing GesmbH., Linz European Coordinating Committee for Artificial Intelligence ************************************************* * For a free INVITATION PROGRAM please contact: * ************************************************* by E-mail: flai93_info@vexpert.dbai.tuwien.ac.at (automatic reply with latest information), or Ms. Heidi Milos - FLAI'93 Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6125 Fax: +43-1-5055304 E-mail: flai93_secr@vexpert.dbai.tuwien.ac.at -------------------Cut-Here-For-Registration-Form------------------- REGISTRATION FORM - FLAI'93 - ANMELDUNGSFORMULAR Eight Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Full name [] Ms. [] Mr. [] Dr. [] Prof.: Name as you would like it on your badge: Address: Telephone: Fax: E-Mail: Tutorials June 28, 1993 (auf Deutsch / in German, mit Mittagessen) [] Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH/ELITE Aachen ATS 2,000.- [] Nachmittag: Fuzzy Control-Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig ATS 2,200.- [] Ermaessigte Gebuehr fuer Teilnehmer an beiden Tutorials ATS 3,700.- Technical Program June 28-30, 1993 (including workshops, proceedings, receptions and lunches) until May 14, 1993: [] ATS 1,900.- [] Full-time student* ATS 800.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. after May 14, 1993: [] ATS 2,300.- [] Full-time student* ATS 1,000.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. [] for participants of tutorials / fuer Tutorialteilnehmer ATS 1,500.- [] OEGAI members: substract ATS 150.- (applies only once) Bed and breakfast at the conference site / Unterkunft und Fruehstueck am Tagungsort Accommodation at the conference site is ATS 500.- per night and person. Very few double rooms are available directly at the conference site. [] Please reserve [ ] single rooms [ ] double rooms Arrival date: Departure date: [] ATS 500.- x [ ] nights x [ ] persons = =====> TOTAL in Austrian Schillings (ATS) = _______________________________________________________________________ Method of Payment / Zahlungsmodus [] Transfer to bank account / Ueberweisung auf Konto [] Postal Giro account "OEGAI", no. 92,016-129, Vienna. [] Die Erste Oesterreichische Spar-Casse-Bank Wien "OEGAI", Konto-Nr. 004-71186, BLZ 20111 [] Eurocheque / Euroscheck (Please make cheque payable to "OEGAI") All cheques should be in Austrian Schillings (ATS 100.- corresponds to approximately US$ 8.55). Payment must accompany registration. In order to keep registration costs down, regretfully, credit card payments are not accepted. Please make the delegate's name clearly legible on all money transfers. [] Invoice required / Eine Rechnung wird benoetigt Date / Datum: Signature / Unterschrift: Please send your registration to / Bitte senden Sie Ihre Anmeldung an Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 ------------------------------------------------------------------------- Call for Participation to the PhD-workshop at the FLAI'93 Eight Austrian Artificial Intelligence Conference FLAI'93 Fuzzy Logic in Artificial Intelligence June 28, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Call for Participation "Workshop for Doctoral Students in Fuzzy-Based Systems" A workshop for about 20 PhD students from European universities to be held in conjunction with the FLAI'93 conference is proposed. This one-day-workshop is intended to enhance the personal and professional development of PhD-level students who are working in the field of fuzzy-based systems. It shall enable them to meet, to dicuss their research, and to develop their working skills. It will also serve as an introduction to the European Fuzzy-Mail-List established by Wolfgang Slany, the FLAI'93 workshop coordinator. This network enables the participants to exchange information, give help and support, and to give wider access to resources and methods. Although the network is set up and based in Europe, it is connected to the fuzzy-related list of the North American Fuzzy Information Processing Society, and will be connected to other fuzzy related elecetronic media in the future. Attendants of the workshop will be asked to either send a one-page abstract of their dissertation research or a technical position statement of particular interest to PhD students in fuzzy-based systems. The abstracts will be distributed to the workshop participants and serve as the basis for the technical discussion at the workshop. Please, send your abstract by e-mail or as paper copy to one of our adresses given at the end of this document. The workshop is intended to focus on both technical exchange of ideas among the participants and non-technical discussion of issues of particular interest to PhD students. It is planned to discuss the topic of writing a PhD thesis. This discussion will be supported by a talk of an experienced researcher in the field of fuzzy-based systems (to be named). For other topics, senior facilitators will also be invited. The general form of the workshop shall be interactive, focussing on active work in small groups and in the whole group. The workshop shall be divided into three major parts: o mutual introduction o technical program o non-technical program Each of the parts will be covered in one or more sessions over the day. The results shall be covered in a report covering the technical as well as the non-technical results of the day. Parts of the report will be written by the participants during the workshop. The report will either be published in conjunction with other FLAI'93 workshop publications or, if this is not possible, as a distinct publication. A time schedule of the workshop will be distributed later. For further questions you can contact us at the following adresses: Bernhard Moser Institute f. Computer Sciences, Salzburg University Hellbrunnerstr. 34 A-5020 Salzburg, Austria Tel: (+43)-662-8044-5318 Fax: (+43)-662-8044-5010 email: 1moser@edvz.uni-salzburg.ada.at Johann Gamper Institute f. Medical Computer Sciences, Vienna University Waehringer Guertel 18-20 A-1090 Vienna, Austria Tel: (+43)-1-40400-3494 Fax: (+43)-1-4052988 email: gamper@wiimc12.imc.univie.ac.at Sincerly - Bernhard Moser and Johann Gamper - Information on how to subscribe already now to the fuzzy-mail list follows: ------------------------------------------------------------------------- Announcement and Call for Participation for a European FUZZY-MAIL-LIST An automatic mailing list (Unix-based Listserv) for all persons interested in topics related to Fuzzy Set based methods has been established. To participate, you just have to send an electronic mail containing the following two lines to listserv@vexpert.dbai.tuwien.ac.at HELP SUBSCRIBE FUZZY-MAIL Your Full Name where you replace "Your Full Name" by your real name (please do NOT specify your E-mail address here as it will be automatically extracted from the header of your mail). You will get two answers, one in response to the HELP command above, explaining other commands that you can send to listserv@vexpert.dbai.tuwien.ac.at (as for unsubscribing), plus one welcome mail in response to your SUBSCRIBE command from above. All messages sent from other participants to *************************************************************** * * * fuzzy-mail@vexpert.dbai.tuwien.ac.at * * * *************************************************************** will be forwarded to you (if you want to get your own messages for confirmation, send a SET FUZZY-MAIL MAIL ACK command after you got the confirmation of your subscription again to the address listserv@vexpert.dbai.tuwien.ac.at). Archives and various informative files can be found by sending the INDEX and GET commands to listserv@vexpert.dbai.tuwien.ac.at, see the explanations in help for full details. One example is the "Who is Who in Fuzzy" file that can be retrieved by sending the command GET LISTSERV WHOISWHOINFUZZY to listserv@vexpert.dbai.tuwien.ac.at To be included in this file, send the correctly formatted entry and all changes directly to Robert Fuller, e-mail: rfuller@finabo.abo.fi (please do not send them to fuzzy-mail). The list has been interconnected with the NAFIPS-L mailing list of the North America Fuzzy Information Processing Society. All messages sent to one of the lists will be forwarded automatically to the other one. In the near future, I will try to interconnect this mailing list with the Fuzzy-Mailing lists from Japan and South-Korea, as well as with the fuzzy-newsgroup comp.ai.fuzzy. The reason for creating a separate European Fuzzy-Mail list is that not everybody has news-access, and traffic can be enormously reduced by links between worldwide distributors. For further questions, please get in contact with me at Wolfgang Slany Christian Doppler Labor fur Expertensysteme Institut fur Informationssysteme (Nr. 184/2) Technische Universitat Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6123 Fax: +43-1-5055304 E-mail: wsi@vexpert.dbai.tuwien.ac.at Enjoy! ------------------------------------------------------------------------- OeGAI FLAI'93 28. Juni 1993 FLAI'93 - Fuzzy Logic in Artificial Intelligence Eight Austrian Artificial Intelligence Conference FLAI'93 Workshop FUZZY LOGIC FUER WIRTSCHAFT UND INDUSTRIE FUZZY LOGIC FOR COMMERCIAL AND INDUSTRIAL APPLICATIONS 28. Juni 1993, Bildungshaus St. Magdalena, Linz, Austria Ankuendigung und Einladung fuer Workshop-Beitraege Sprachen: Deutsch/Englisch Languages: German/English Der FLAI'93 Workshop "Fuzzy Logic fuer Wirtschaft und Industrie" findet im Rahmen der 8. Austrian Artificial Intelligence Konferenz am 28. Juni im Bildungshaus St. Magdalena, Linz statt. Konferenzteilnehmer finden im Rahmen dieses Workshops Gelegenheit, Anwendungen von Fuzzy Logic, Beurteilung der Wirtschaftlichkeit von Fuzzy-Logic Anwendungen, vergleichende Studien, Probleme und Kritik in einem informellen Rahmen zu praesentieren und zu diskutieren. Als Workshopsprache ist Deutsch vorgesehen, die Vortragsdauer fuer einen Workshopbeitrag ist auf 20 Minuten Vortrag mit anschliessender Diskussion (insgesamt 30 Minuten) beschraenkt. Workshop Themen o Anwendungen von Fuzzy Logic zum Beispiel aus einem der folgenden Gebiete: Finanzdienstleistungsbereich, Entscheidungsunterstuetzende Systeme, Industrie, Handel, Marketing, Regelungstechnik, Produktionsplanung und -steuerung, Oekologie, Umweltschutz, ... o Probleme und Kritik. o Wirtschaftliche Aspekte. o Vergleichenden Studien. o Entwicklungsmethodik und Vorgehensmodelle. Beitraege Workshopteilnehmer werden aufgefordert, Beitraege zu einem dieser Themen mit einer maximalen Laenge von 10 DIN-A4 Seiten einschliesslich Titel, Abbildungen, Tabellen und Referenzen einzureichen. 2 Kopien der Beitraege sind an einen der Organisatoren (Adresse unten) zu schicken. Angenommene Beitraege werden in einem Workshop-Band den Workshop-Teilnehmern zur Verfuegung gestellt. Wichtige Termine Einreichen von Beitraegen bis spaetestens 1. Mai 1993. Benachrichtigung ueber Annahme bis 15. Mai 1993. Druckfertige Beitraege bis spaetestens 1. Juni 1993. Workshop Organisatoren Ing. Peter Kotauczek BEKO GmbH Weiszgerberlaende 38 A-1030 Wien, Oesterreich Tel: +43 1 713 37 33 Fax: +43 1 713 31 20 46 Dr. Andreas Geyer-Schulz Lehrstuhl fuer Betriebswirtschaftslehre/Wirtschaftsinformatik WISO-Fakultaet, Universitaet Augsburg Memmingerstrasse 18, D-8900 Augsburg, Deutschland and Dr. Andreas Geyer-Schulz Abteilung fuer Angewandte Informatik insbesondere Betriebsinformatik Institut fuer Informationsverarbeitung und Informationswirtschaft Wirtschaftsuniversitaet Wien Augasse 2-6, A-1090 Wien, Oesterreich Tel: +43 1 330 36 36-31 Fax: +43 1 330 36 36-10 E-mail: geyers@uxe.wu-wien.ac.at ------------------------------------------------------------------------- Call for Participation Eight Austrian Artificial Intelligence Conference FLAI'93 Fuzzy Logic in Artificial Intelligence June 28, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Karl Menger, Fuzzy Logic and Artificial Intelligence -- An Experiment in Reflection The aim of this workshop is an unorthodox "investigation" into the logical and philosophical foundations and into the historical developments concerning the relationship between FL and AI. Special emphasis is placed upon the mathematical and philosophical contributions of Karl Menger (and perhaps other members of the Vienna Circle in the 1930th). Of special interest is the idea of *concept formation* (due to fuzzy set theory or other approaches -- e.g. connectionist ones) and the way in which our so-called outer world is grasped or represented by those (perhaps fuzzy) concepts which surely provide the basis for a sound information processing by human beings crediting both scientific and common-sense approaches to knowledge acquisition in general. For further information, please contact Rainer Born Inst. f. Phil. and Philosophy of Science Johannes Kepler University A-4040 Linz, Austria tel.: 0043 (0)732 2468-496 (or 499), E-mail K270190@ALIJKU11 (bitnet) or K270190@EDVZ.UNI-Linz.AC.AT (internet). ------------------------------------------------------------------------- FLAI'93 Workshop "Fuzzy Scheduling Systems" 28th June 1993, Bildungshaus St. Magdalena, Linz, Austria Call for Participation Scheduling is an activity which is often based on uncertain time estimates and loosely specified preferences and constraints which can often be relaxed. An increasing number of researchers have recently started to explore the potential uses of fuzzy set theory, fuzzy logic and fuzzy arithmetic to assist in the more realistic representation of the uncertainty and vagueness often inherent in schedules. This workshop is intended to provide a forum for those having an interest in this field to meet for the presentation and discussion of recent research, to raise possible research or philosophical issues, and to report on applications. The format of the workshop will consist of a series of individual presentations with a total of thirty minutes (including discussion) being allowed for each. The language of the Workshop will be English. Themes . fuzzy scheduling heuristics . fuzzy preference constraint representation and relaxation . temporal constraint representation and propagation using fuzzy arithmetic . fuzzy knowledge elicitation: mapping linguistic scheduling variables and preferences on to fuzzy sets . methods of comparative evaluation of crisp and fuzzy schedules . philosophical implications . case studies Participation Intending participants are invited to to submit (in English) two copies of an extended abstract on one of the above themes to Roger Kerr at the address below. The length of the abstract, including diagrams, tables and references, should not exceed 5 double-spaced A4 pages at 10cpi pitch. A complete set of copies will be distributed to participants at the workshop. Roger Kerr Christian Doppler Institute for Expert Systems Technical University of Vienna Paniglgasse 16 A-1040 Vienna Austria Tel ++43-1-58801-6112, Fax ++43-1-5055304 ------------------------------------------------------------------------- FLAI'39 - Tutorials am 28. Juni 1993 (auf Deutsch / in German, mit Mittagessen und Kaffeepausen) Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Vortragender: Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH/ELITE Aachen Die in den letzten 25 Jahren entwickelten Methoden der Fuzzy Set Theorie sind in besonderem Masze eine Grundlage fuer das Gebiet der Expertensysteme. In diesem Tutorial sollen zunaechst Grundlagen und Methoden der Fuzzy Set Theorie besprochen werden. Besonderer Wert wird auf das Gebiet der Fuzzy Inferenz gelegt werden. Danach wird ihre Anwendung auf Expertensysteme diskutiert, wobei beispielhaft die strategische Planung und die Steuerung flexibler Fertigungssysteme im Vordergrund stehen wird. Nachmittag: Fuzzy Control-Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Vortragender: Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig In diesem Tutorial werden in einer kurzen Einfuehrung zunaechst die fuer das Verstaendnis der Fuzzy-Regelungstechnik benoetigten Grundlagen der Theorie der Fuzzy-Mengen behandelt und die klassischen Methoden der Fuzzy-Regelung erlaeutert. Daran schlieszt sich eine ausfuehrliche Diskussion der Anwendung von Fuzzy Control im industriellen Umfeld und die Vorstellung einer neuartigen Entwicklungsmethodik an. In diesem Zusammenhang werden mehrere Fallbeispiele detailliert behandelt, so dasz die Kursteilnehmer einen Eindruck von der praktischen Relevanz der vorgestellten Methode gewinnen. Die Teilnehmer des Kurses erhalten das Buch "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993". ------------------------------------------------------------------------- ECCAI Travel Awards FLAi'93 is officially sponsored by ECCAI, the European Coordinating Committee for Artificial Intelligence. Therefore members of ECCAI organizations applying to ECCAI's Travel Award fund will receive preferential treatment when applying to attend FLAI'93. An ECCAI Travel Award Scheme has been established with a current annual budget of 4000 Ecu. The formal regulations are set out below. * ECCAI is offering cash awards for travel to a European or International conference or workshop in artificial intelligence, and in particular to ECAI conferences and ACAI courses. Young researchers in university, industry and teaching often have difficulty raising money to visit such an event. The purpose of these awards is to help people who are at an early stage in their careers in artificial intelligence. * A basic understanding of the field is expected so that the visit should enrich existing knowledge and not be used as a training exercise. Grants to reimburse up to 75 % of total costs are available. Applicants must be affiliates of an ECCAI member association at the time they apply. * Applicant should send a CV, a case for support, and evidence that they would be allowed leave to attend the event, to the address below as soon as possible and certainly to arrive no later than 6 weeks before the proposed travel date. * The case for support should be no more than three pages, should be signed by the applicant, and should contain: 1. Evidence that the applicant has an existing interest and expertise in artificial intelligence; 2. Reasons why ECCAI should make the award to the applicant and a description of the part the applicant will play in the conference or workshop. 3. The amount that the visit will cost together with evidence of any financial contribution from other sources, granted or applied for. Applications will be considered by the ECCAI board. Successful applicants will be expected to demonstrate what they have gained from the visit by writing a report of the event for AI Communications, that will possibly be considered for inclusion. For further information, or submission of requests contact: ECCAI Secretariat - Travel Awards IRST Istituto per la Ricerca Scientifica e Tecnologica 38050 Povo (Trento), Italy Fax: +39 461 810851 (No E-mail submission or requests) ------------------------------------------------------------------------- Best regards, and see you in Linz at FLAI'93, Wolfgang SLANY FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Mrs. Heidi MILOS at +43-1-5055304 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send "subscribe fuzzy-mail Your Real Name" as a message to | | listserv@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like "help" to listserv@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From mas@informatik.uni-kiel.dbp.de Fri Mar 26 12:08:08 1993 Relayed; Fri, 26 Mar 1993 12:16:19 +0100 Fri, 26 Mar 1993 12:17:17 +0100 Fri, 26 Mar 1993 12:16:32 +0100 Fri, 26 Mar 1993 12:14:14 +0100 Fri, 26 Mar 1993 12:13:41 +0100 Date: Fri, 26 Mar 1993 12:13:41 +0100 From: Meinolf Asshoff Subject: Fuzzy Logic in Ecological Modelling, MAIL PROBLEMS To all interested in the workshop Fuzzy Logic in Ecological Modelling October 12-14, 1993 Ecosystem Research Center, University of Kiel, Germany Dear colleagues, 1. If you have sent an e-mail to me and did not receive any response from me, please send it again to: mas@informatik.uni-kiel.de Since a few weeks we have e-mail transfering problems and it's possible I didn't receive your e-mail. Please send me your abstract or your registration in addition to e-mail by paper-mail or fax. 2. Deadline for abstracts is extended to April 30, 1993. I apologize for my typing error in the 2nd CFP. Best regards A. Salski Projektzentrum Oekosystemforschung Universitaet Kiel Schauenburgerstr. 112 D-2300 Kiel 1, Germany Fax: ++49 431 880 40 83 -- Meinolf Asshoff mas@informatik.uni-kiel.de Ecosystem Research Center University of Kiel Germany From wsi@altair Fri Mar 26 17:21:15 1993 Date: Fri, 26 Mar 93 17:27:30 +0100 From: wsi@altair (Wolfgang Slany) Subject: Summary of Fuzzy-Neural System & Adaptive Fuzzy Control ----- Begin Included Message ----- Date: Thu, 25 Mar 1993 13:35:34 -0600 From: Chaohui Yang Subject: Summary of Fuzzy-Neural System & Adaptive Fuzzy Control <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><> <> A Brief Summary of Information Received <> <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><> In Comp.ai.fuzzy, I wrote: >As I understand, one method to do adaptive fuzzy logic control is to use >those called "self-learing fuzzy neural-networks". It will automatically fine >tunes rules and membership functions and adapt to new conditions. But, is >there any system that avoid using neural nets for adaptive fuzzy control? >i.e, any algorithms that use only fuzzy logic concept for real-time >adaptation of a fuzzy logic system. >I would appreciate anyone who will recommend some papers on this topic. <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< I would like to appreciate all those people who sent me the following information about FUZZY NEURAL SYSTEMS and ADAPTIVE FUZZY LOGIC CONTROL. -- Chaohui Chaohui Yang Laboratory for Intelligent Systems University of Minnesota-Duluth Duluth, MN 55812 voice: (218) 726-6194 e-mail: cyang@ub.d.umn.edu <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< I have put a somewhat updated version of my list of references of fuzzy-neuro articles on our ftp-server. There you can also find some of our contributions to this field. Connect to ftp.tu-bs.de (= 134.169.34.15, anonymous ftp) and look in pub/local/papers/ for the files: fuzzy-nn.bib: ASCII-File, BibTeX format, list of references iizuka92.ps.Z, ifis92.ps.Z, nafips92.ps.Z, icnn93.ps.Z: papers for the respective conferences shown in the filename, all about our neuro-fuzzy approaches (postscript files, ready to print after uncompressing, binary files!) I will also try to put these files to the fuzzy logic ftp-server of Tim Butler (ntia.its.bldrdoc.gov). Detlef nauck@ibr.cs.tu-bs.de (Detlef Nauck) <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< Some suggestions: Oden, G. C. (1979). Fuzzy propositional approach to psycholinguistic problems: An application of fuzzy set theory in cognitive science. In M. M. Gupta, R. K. Ragade, & R. R. Yager (Eds.) Advances in Fuzzy Set Theory and Applications. Amsterdam: North-Holland. Oden, G. C. (1984). Integration of fuzzy linguistic information in language comprehension. Fuzzy Sets and Systems, 14, 29-41. Oden, G. C. (1988). FuzzyProp: A symbolic superstrate for connectionist models. Proceedings of the IEEE International Conference on Neural Networks, Vol. I, 293-300. Oden, G. C., Rueckl, J. G., & Sanocki, T. (1991). Making sentences make sense, or words to that effect. In G. B. Simpson (Ed.), Understanding word and sentence. Amsterdam: North-Holland. Oden, G. C. (1992). Direct, incremental learning of fuzzy propositions. Proceedings of the Fourteenth Annual Conference of the Cognitive Science Society. From: tlund@news.weeg.uiowa.edu (Thomas Lund) <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< Dear Mr. Chaohui I think you are looking for Fuzzy Self Organizig algorithm. This type of research has been done by Mamdani. But my personal idea is that algorithm is not organized well. Meanwhile I have seen a new article in recent issue of Fuzzy Set & Systems (March 93) about abaptive rule correction. I hope it be useful Regards A.Lotfi >From lotfia@s1.elec.uq.oz.au Wed Mar 24 02:21:10 1993 <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< There are some other ways to tune FLC. You can for example adjust rules or membership functions. Adjusting membership functions sounds better to me. Unfortunately I don't know any tools to do that. Papers: Batur C., Kasparian V : Adaptive Expert Control, International Journal of Control, Vol 54, no.4.1991,pp 867-881. Maeda A,Sato T, Mirakami S: Design of the Self-Tuning Fuzzy Controller , Proceedings of the International Confe- rence on Fuzzy Logic & Neural Networks, July 1990,pp.393-396. (this handles tuning with neural networks) Maeda A,Someya R, Funabashi M: A Self-Tuning Algorithm for Fuzzy Membership Functions Using a Computational Flow Network. IFSA'91 (International Fuzzy Systems Association),1991. (this sounds good) In my opinion the main problem is that you have to use some performance index or indexes. Normally you can get them, but how they should tune the FLC ?? Batur &al. discuss about this. I hope you will get the information you need. Tapio Rauma Technical Research Centre of Finland Computer Technology Laboratory >From etr@tko.vtt.fi Mon Mar 22 01:13:51 1993 <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< Hi, I am sending you some of my papers on this area. Saman >From saman@microelectronic.e-technik.th-darmstadt.de Tue Mar 16 06:30:56 1993 --------------------------------- @INPROCEEDINGS{Hal92-2, AUTHOR = {S. K. Halgamuge and M. Glesner}, TITLE = {{A Fuzzy-Neural Approach for Pattern Classification with the Gen eration of Rules based on Supervised Learning}}, BOOKTITLE = {Neuro-Nimes 92}, ADDRESS = {Nimes, France}, MONTH = {November}, YEAR = {1992} PAGES = {165--173} } @INPROCEEDINGS{Hal93-1, AUTHOR = {S. K. Halgamuge and W. Poechmueller and M. Glesner}, TITLE = {{A Rule based Protoype System for Automatic Classification in Industrial Quality Control}}, BOOKTITLE = {ICNN 93}, ADDRESS = {San Fransisco, USA}, MONTH = {March}, YEAR = {1993} } <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< You may want to look at: Romaniuk, S.G., Hall, L.O. (1993) SC-net: A Hybrid Connectionist, Symbolic System, To appear Information Sciences. Romaniuk, S.G. Hall, L.O., (1992) Decision making on creditworthiness, using a fuzzy connectionist model, Fuzzy Sets and Systems 48, pp. 15-22. and Romaniuk, S.G. (1993) Fuzzy Rule Extraction for Determining Creditworthiness of Credit Applicants, Technical Report TR20/92. For Fuzzy Control Application: Romaniuk, S.G. (1993) Learning Fuzzy Control with Hybrid Symbolic, Connectionist Networks, FUZZ-IEEE'93, San Francisco. Other approaches: Keller, J., Tahani, H (?) Backpropagation Neural Networks for Fuzzy Logic. Information Sciences. Steve G. Romaniuk DISCS National University of Singapore 10 Kent Ridge Crescent Singapore, 0511 >From iscsr@nuscc.nus.sg Mon Mar 15 19:27:34 1993 <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< END OF FILE <><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><><>< ----- End Included Message ----- From @prg.oxford.ac.uk:hje@robots.oxford.ac.uk Mon Mar 29 12:17:27 1993 Relayed; Mon, 29 Mar 1993 12:48:40 +0200 Mon, 29 Mar 1993 13:49:28 +0200 Mon, 29 Mar 1993 13:48:31 +0200 Mon, 29 Mar 1993 12:45:37 +0200 Mon, 29 Mar 1993 12:38:18 +0200 Mon, 29 Mar 1993 12:38:05 +0200 Mon, 29 Mar 1993 12:38:05 +0200 Date: Mon, 29 Mar 1993 12:38:05 +0200 From: hje@robots.oxford.ac.uk BABB@sst.icl.co.uk, BRAMERMA@CSOVAX.PORTSMOUTH.ac.uk, BRIANB , BRIANB@ibmpcug.co.uk, CONROY@UMIST.ac.uk, CSLAURIE@pyramid.swanse, D.W.Edwards@loughborough.ac.uk, DEE801@POLY-EAST-LONDON.ac.uk, DMCS@computing.lancaster.ac.uk, D_LLOYD , D_LLOYD@compulink.co.uk, EDWARDSJS@ASTON.ac.uk, EINA@ccvax.unicamp.ansp.br, ERA021@CENTRAL1.LANCASTER.ac.uk, G.JOLY@uk.ac.UCL.CS, GREEN , GREEN@apre.mod.uk, "GRIGORIS.KARAKOULAS" , GRIGORIS.KARAKOULAS@ISOSUN.ariadne-t.gr, GUPTAM@sask.usask.ca, GUPTAM@sask.usask.ca, HART_A@PRIME1.LANCASHIRE-POLY.AC.UK, HILARY@DCS.QMW.ac.uk, HJE , HJE@robots.oxford.ac.uk, HUI@dcs.bbk.ac.uk, I.CHIVERS@ASH.CC.KCL.ac.uk, I7110205 , IGNIZIO , IGNIZIO@UH.edu, ISSWPZ@NUSVM.BITNET, JACK , JACK@AI.IIT.nrc.ca, JHUNTER@COMPUTING-SCIENCE.ABERDEEN.ac.uk, KEITHC , HEL!KEITHC, KEN@UK.AC.STRATHCLYDE.CAD-CE, KEN@cad-centre.strathclyde.ac.uk, L.Rolfe@qmw.ac.uk, ME_JNRJ@VAXA.NERC-MERLEWOOD.AC.UK, NRS@PSYCHOLOGY.NOTTINGHAM.ac.uk, PEDWARDS@COMPUTING-SCIENCE.ABERDEEN.ac.uk, PEKLUND@finabo.abo.fi, PGRAY@COMPUTING-SCIENCE.ABERDEEN.ac.uk, PH , PH@hci.heriot-watt.ac.uk, PSG057@CENTRAL1.LANCASTER.ac.uk, RDYBOWSKI@PORTIA.UMDS.LON.ac.uk, RICHARD@buggi.or.rwth-aachen.de, SGES@ea-technology.co.uk, SKAHN@Twins.GoldStar.CO.KR, SLC@risc.rockwell.com, TOM.ADDIS@READING.ac.uk, UKPDSRH@VAX.OXFORD.ac.uk, VANGELIS@KSUVM.tuwien.ac.at, YKL11@PHOENIX.CAMBRIDGE.ac.uk, alex@spindletop.tamu.edu, arras@forwiss.uni-erlangen.de, badami@crd.ge.com, berenji@pluto.arc.nasa.gov, bonissone@crd.ge.com, c1407@trl.mei.co.jp, cclee@diva.Berkeley.EDU, chizuru@cc.u-tokai.ac.jp, eletter@ivy.Princeton.EDU, fuzzy-mail@vexpert.dbai.tuwien.ac.at, fuzzy@prec.osaka-u.ac.jp, gebhardt@gmd.de, glen@diva.berkeley.edu, guo@rhum.gmd.de, hah@smaragd.zfe.siemens.de, hall@usf.edu, hartman@pav.mcc.com, hayashi@ibaraki.ac.jp, hje@robots.oxford.ac.uk, mamdani@robots.oxford.ac.uk, dex@prg.oxford.ac.uk ter@robots.oxford.ac.uk, linkens@robots.oxford.ac.uk uk, burton@ul.ie, S.Farrall@eng.warwick.ac.uk, qs@uk.ac.hw.cee, mr.sys.uea.ac.uk, D.W.Edwards@uk.ac.lut, korn, info@til.com, jamesj%mon1@melpar-emh1.army.mil, jang@diva.berkeley.edu, khedkar @janus.berkeley.edu, kogure@ams.mei.co.jp, nagisetty@com.ford.srl.comet, nakatsu@jp.ac.yamagata-u.yz.ea5, nauck@de.tu-bs.cs.ibr, neuro@it4.crl.mei.co.jp, ohara@mcc.com, ppw@dukee.egr.duke.edu, remmele@ztivax.siemens.com, rlea@nasamail.nasa.gov, sun@cs.berkeley.edu, takagi@cs.berkeley.edu, yamachan@lab1.fuzzy.or.jp, yen@cs.tamu.edu, zuliang@iss.nus.sg, zuliang@sg.nus.iss Subject: Fuzzy Control Two Decades of Fuzzy Control Parts 1 and 2 18-19 May 1993 Program PART 1 18 May -------------- 10:00 Introduction and Welcome Janet Efstathiou University of Oxford 10:05 Tutorial on Fuzzy Control Richard Stobart Cambridge Consultants 10:25 Fuzzy Control in Japan - Prof Abe Mamdani Learning Lessons Queen Mary and Westfield College 11:30 Dedicated Silicon Solutions Lou Kourra for Fuzzy Logic Systems VLSI Technology 11:30 Cement Kiln Control Walter Henderson ABB LINKman 12:00 LUNCH 1:00 Fuzzy Control Applied to Simon Farrall Automotive Vehicles ATC, Rover Group 1:30 Some Control Aspects of M T Iqbal, A H Coonick and L L Freris a Wind Turbine Imperial College 2:00 Fuzzy Logic Control of a Eoghan O'Lionaird and D P Burton Pearlite Plant Mitsui Kinzoku Engineering and University of Limerick 2:30 Fuzzy Planning for Task Level Chris Harris and N J W Rayner Mission Management of Southampton University and Easams Ltd. Autonomous Vehicles 3:00 TEA 3:15 Monitoring and Control of Bob Sutton Nuclear Plant Using Fuzzy University of Plymouth Logic 3:40 Residential Environmental Peter MacConnell Regulation using University of Exeter Intelligent Fuzzy Control 4:05 CLOSE PART 2 19 May -------------- 10:00 Introduction and Welcome Janet Efstathiou University of Oxford 10:05 Generic Supervisory Fuzzy Derek Linkens Logic Control University of Sheffield 10:35 Fault Detection in Air- Arthur Dexter Conditioning Systems using University of Oxford Fuzzy Models 11:05 Fuzzy Qualitative Modelling Qiang Shen, Roy Leitch and G Coghill Heriot-Watt University 11:35 Capital Cost Estimating for David Edwards Chemical Process Plants Loughborough University using Fuzzy Matching 12:05 Fuzzy Learning Based on Ranjan Vepa Variable Structure Control Queen Mary and Westfield College Systems Theory 12:30 LUNCH 1:30 Fuzzy Output Sets: Their M Brown and Chris Harris (Mis)Use in Fuzzy Modelling University of Southampton and Control 2:00 Probabilistic, Fuzzy and Jim Baldwin Evidential Reasoning in FRIL University of Bristol 2:30 Implementaion of Neural Brian Grant Network Fuzzy Controller Omron European Technical Centre 3:00 TEA 3:15 Design of a Fuzzy Multivariable I M Koutli Technique Based upon Human GEC Avery Technology Ltd Behaviour 3:40 Application of Fuzzy Logic Moe Razaz to Layout of Integrated University of East Anglia Circuits 4:15 Fuzzy Logic and Perturbations John Lever in Feedback Systems Systems Services 4:35 Systems Modelling with Natural Janos Korn Language and Fuzzy Logic Middlesex University 4:55 CLOSE Both events will be held at the Institution of Electrical Engineers, Savoy Place, London, UK. Fee for IEE members 40 pounds. Non-members 60 pounds. Student IEE members No Charge. Lunch ticket (inc VAT) 7.25 pounds. Registration Fee includes admission, digest, tea, coffee and biscuits. For further details, telephone +44 (0)71-240 1871, extn 2206, or write to Secretary, LS(D)CA, IEE, Savoy Place, London WC2R 0BL, UK. From rhaber@iai.es Mon Mar 29 14:56:12 1993 Relayed; Mon, 29 Mar 1993 15:27:38 +0200 Mon, 29 Mar 1993 16:28:32 +0200 Mon, 29 Mar 1993 16:28:12 +0200 Mon, 29 Mar 1993 01:02:33 +0200 Date: Mon, 29 Mar 1993 01:02:33 +0200 Conversion: Prohibited From: rhaber Subject: Adaptive Fuzzy Control Some remarks send to Mr. Chaohui ================================================================= Dear Mr. Chaohui The idea of Adaptive Fuzzy Control Systems is not new. As pointed out Mr. Lotfi, already Mamdani made the first steps in that field with his SOC. Other SOC's have been reported afterwards: -Shao, in Fuzzy Sets and Systems, 151-164, 1988 -Tanscheit and Scharf, in Fuzzy Sets and Systems, May 1988 -Harris and Moore, in Eng. Appl. of AI, Dec. 1989 -Bare, Mulholland and Sofer in IEEE Trans. on AC, Feb. 1990 -Linkens and Hasnani, in IEE Proc.-D, May 1991 Other papers clearly concern Adaptive Fuzzy Control, i.e.: -Cheng, Huang and Ho, in 9th IFAC Congress, Budapest, 1984 -Ollero and García Cerezo, in Fuzzy Sets and Syst., 30, 1989 -Hayashi in Proc. of 5th IFSA, Brussels, 1991 The adaptation by on line modifying membership functions has successfully explored by -Bartolini and others, in Sugeno (ed) Ind. Appl. of Fuzzy Control, 1985. Nevertheless, in my opinion, Adaptive Fuzzy Control remains as a very interesting research field in theory and applications. Yours, Rodolfo Haber From RFULLER@finabo.abo.fi Tue Mar 30 09:15:14 1993 <01GWEZ2V5L4G8Y81T1@finabo.abo.fi>; Tue, 30 Mar 1993 10:14:56 EET Date: 30 Mar 1993 10:14:55 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Statistics about Who is Who in Fuzzy Mime-Version: 1.0 Dear Colleagues, For the time being, we have 52 contributions from the following countries Austria 8 France 3 Belgium 5 Germany 8 Denmark 2 Hungary 6 Finland 7 Italy 1 Japan 1 Switzerland 1 Norway 1 United Kingdom 2 Romania 1 USA 1 Spain 5 The "whoiswhoinfuzzy" file contains now approximately one third of the total members of Fuzzy Mail. Please keep me sending your actual addresses for communications and topics of interests. With best wishes. Robert. From @HUEARN.SZTAKI.HU:H1133Mar@huella.bitnet Tue Mar 30 12:56:16 1993 Tue, 30 Mar 93 12:56:34 SET gmt+1 Subject: research offer From: H1133Mar@huella.bitnet Date: 30 Mar 93 12:42:13 +0100 Dear Professor This message has been sent to you, but the E-mail did not work well, and we are sending it again. We, Andreja Tepavcevic and Branimir Seselja, are on the teaching staff at the institute of Mathematics, University of Novi Sad (our C.V's are included). For some time we have been working on the problems in the algebraic fuzzy set theory and its applications (some of our recent results have been published in FSS 52 and FSS 53). Our concept of a fuzzy set is based on lattices, and more generally, on relational systems. By this approach, we can deal with problems arising in the applications of fuzzy sets. The results appear to be more readily applicable than those obtained by "classical" fuzzy sets (roughly speaking, the difference between relational valued and "classical" fuzzy sets is comparable to the one between colour and b/w picture). In particular, our interests lie in the coding theory, pattern recognition, information sciences etc. The situation in our country prevents us from using appropriate equipment and maintaining necessary contacts with collegues and institutions outside Yugoslavia. Therefore, we would be happy to accept professional work for a period of time at any institution interested in applications and use of the fuzzy set theory, and one which would provide the framework for intensive research. If there is such a possibility at your Institute, or if you know the one to which you can transfer this message, please let us know. However, we must ask you to use the E-mail of professor L.Marki in Budapest, noting that the message is for B.Seselja. Yours sincerely Andreja Tepavcevic Branimir Seselja BRANIMIR SESELJA C.V. Born: 1948 Sex: male Nationality: Yugoslav (croat extraction) Languages: Mother-tongue:Serbo-Croat, Fluent: English and French, Communicative competence in Russian Degrees: B.Sc.1972. Mathematics, M.Sc.1976. Mathematics-Algebra, Ph.D.1981. Mathematics-Algebra Employment: 1973-76 Faculty of Technology, University of Novi Sad 1976- Institute of Mathematics, University of N.S. Position: Full Professor Teaching assignments: lectures in: Theory of Lattices and Boolean algebras, Automata theory, Discrete Theory of Information, Mathematical Elements of Informatics, Introduction to Informatics, Mathematics for students of Agriculture. Supervising researches at the graduate programs in algebra. Fields of interest: Universal algebra, Lattice Theory, Fuzzy set Theory Professional output: c.50 scientific papers (published in Algebra Universalis, Studia Sci.Mat.Hung., General Algebra, Fuzzy Sets and Systems, etc.) and 10 textbooks in mathematics, including a translation from French to Serbo-Croat. Participated in many conferences on topics in Algebra and Fuzzy set Theory. Several invited lectures. Referee for Fuzzy Sets and Systems, reviewer for Mathemtical Reviews, reviewed papers for Discrete Applied Mathematics, Information Sciences and others. ANDREJA TEPAVCEVIC C.V. Born: 1964 Sex: female Nationality: Yugoslav (croat and serbian extraction) Languages: Mother-tongue:Serbo-Croat, Fluent: English, Communicative competence in Spanish and Russian Degrees: B.Sc.1987. Informatics, 1988. Mathematics M.Sc.1990. Mathematics-Algebra, Ph.D. in the process of completion Employment: 1988- Institute of Mathematics, University of N.S. Position: Assistent Lecturer Teaching assignments: practicals in: Mathematical Logic, Algebra, Universal algebra, Discrete Theory of Information, Mathematical Elements of Informatics, Introduction to Informatics, Mathematics for students of Agriculture and Technology. Fields of interest: Universal algebra, Lattice Theory, Fuzzy set Theory Professional output: c.20 scientific papers (published in General Algebra, Fuzzy Sets and Systems, etc.) Participated in several conferences in Universal Algebra and Lattice Theory. One invited lecture. From NAFIPS-L@GSUVM1.BITNET Wed Mar 31 21:28:15 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 2029; Wed, 31 Mar 1993 21:28:15 +0100 Date: Wed, 31 Mar 1993 16:13:20 +0200 From: SEMERZ@FRLMCP61.BITNET Subject: Re: Statistics about Who is Who in Fuzzy > The "whoiswhoinfuzzy" file contains now approximately one third of >the total members of Fuzzy Mail. > Please keep me sending your actual addresses for communications >and topics of interests. I hadn't heard that such a list was being compiled. Please put me on if appropriate. interests: Applications of fuzzy sets in the prediction of protein structure. Thank you sincerely, TTGATTGCTAAACACTGGGCGGCGAATCAGGGTTGGGATCTGAACAAAGACGGTCAGATTCAGTTCGTACTGCTG MICHEL T. SEMERTZIDIS Internet: SEMERZ@LMCP.JUSSIEU.FR University of Paris 6 Bitnet: CNRS URA 09, CASE 115 Phone: Tour 16, 4 place Jussieu, Fax: 75252 Paris Cedex 05, System managers do it with PRIVILEGES! F R A N C E DISCLAIMER:As always,I speak only for myself,and,usually,only to myself. LeuIleAlaLysHisTrpAlaAlaAsnGlnGlyTrpAspLeuAsnLysAspGlyGlnIleGlnPheValLeuLeu From NAFIPS-L@GSUVM1.BITNET Wed Mar 31 23:39:01 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 5073; Wed, 31 Mar 1993 23:39:02 +0100 Date: Wed, 31 Mar 1993 17:23:25 +0200 From: Wolfgang Slany Subject: Call for Papers - Applications of Fuzzy Logic to Reliability RAMS-94 Forwarded From: pelaez@ece.scarolina.edu (Colon Pelaez) Date: 22 Mar 93 16:20:08 GMT Call For Papers 1994 Annual Reliability and Maintainability Symposium Anaheim California, January 25 - 27, 1994 Special session on Applications of Fuzzy Logic to Reliability and Maintainability We are currently planning a session on "Applications of Fuzzy Logic to Reliability and Maintainability" for the 1994 Reliability and Maintainability Symposium (RAMS). RAMS will be held at the Anaheim Marriot Hotel, Anaheim California, January 25-27, 1994. Suggested topics for the session include (but not limited to) Requirements analysis Reliability allocation System Criticality evaluation Applications in assurance sciences etc. If you would like to have a paper considered for the session, please send a 2 page extended abstract to the session chairman by April 15, 1993 for consideration. You will be notified of acceptance by May 15, 1993. Complete draft of the paper and slides for the presentation will be due by the end of July, for review and the final camara-ready paper and 35-mm slides will be due in September 1993. For more information call John Bowles at (803) 777-2689 or Enrique Pelaez at email: Submit papers or abstracts to: John Bowles Electrical and Computer Engineering University of South Carolina Columbia, SC 29208 Tel: (803) 777-2689 FAX: (803) 777-8045 or Enrique Pelaez email: pelaez@ece.scarolina.edu. From balt@shasta.Stanford.EDU Thu Apr 1 08:28:38 1993 Date: Wed, 31 Mar 93 21:01:51 -0800 From: balt@shasta.Stanford.EDU (Florinel Balteanu) help From balt@shasta.Stanford.EDU Thu Apr 1 08:28:59 1993 Date: Wed, 31 Mar 93 21:03:04 -0800 From: balt@shasta.Stanford.EDU (Florinel Balteanu) help From balt@shasta.Stanford.EDU Thu Apr 1 08:29:10 1993 Date: Wed, 31 Mar 93 21:14:25 -0800 From: balt@shasta.Stanford.EDU (Florinel Balteanu) whoiswhoinfuzzy From borowiec@karlsruhe.gmd.de Thu Apr 1 15:26:56 1993 borowiec@fuenen Subject: Re: research offer In-Reply-To: Your message of "Tue, 30 Mar 93 18:43:43 +0200." <9303301056.AA19555@vexpert.dbai.tuwien.ac.at> Date: Thu, 01 Apr 93 11:02:09 +0200 From: borowiec@karlsruhe.gmd.de Thank You for the letter from March 30. Unfortunately, I'm also a foreigner in Germany and have here an temporary contract. Thus, I can do nothing to help You. Greatings, Jan Borowiec From NAFIPS-L@GSUVM1.BITNET Fri Apr 2 23:08:25 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 8763; Fri, 2 Apr 1993 23:08:22 +0100 Date: Fri, 2 Apr 1993 18:23:57 BST From: Newton Maruyama Subject: Re: Statistics about Who is Who in Fuzzy areas: neural-fuzzy systems for modelling and control, application of fuzzy systems to robotics. Newton Maruyama Department of Engineering Science University of Oxford Parks Road, Oxford OX1 3PJ tel: +44-865-273914 fax: +44-865-273906 From NAFIPS-L@GSUVM1.BITNET Sat Apr 3 00:35:03 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 3690; Sat, 3 Apr 1993 00:35:00 +0100 Date: Thu, 1 Apr 1993 10:22:50 UTC+0200 From: Diego Gachet Subject: whoiswhoinfuzzy > The "whoiswhoinfuzzy" file contains now approximately one third of >the total members of Fuzzy Mail. > Please keep me sending your actual addresses for communications >and topics of interests. I hadn't heard that such a list was being compiled. Please put me on if appropriate. Areas of interest : Application of fuzzy systems in Control and Autonomous Robotic Systems. Thank you sincerely, Diego Gachet Dpto. Automatica EScuela Superior de Ingenieros Industriales Universidad Politecnica de Madrid Spain Jose Gutierrez Abascal 2 28002 Madrid Spain e-mail : gachet@disam.upm.es From LISTSERV@GSUVM1.BITNET Sat Apr 3 03:08:13 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 4851; Sat, 3 Apr 1993 03:08:11 +0100 2832; Thu, 01 Apr 93 04:16:04 EST Date: Thu, 1 Apr 1993 04:16:03 -0500 From: Revised List Processor (1.7e) Subject: Rejected posting to NAFIPS-L@GSUVM1 Your message is being returned to you unprocessed because it looks like a LISTSERV command, rather than material you intended to post to the NAFIPS-L list. Please note that LISTSERV commands must ALWAYS be sent to the LISTSERV address; if it was indeed a command you were attempting to issue, please send it again to LISTSERV@GSUVM1 for execution. Otherwise, please accept our apologies and try to rewrite the message with a slightly different wording - possible solutions include changing the first word of the message, quoting it, inserting a line of dashes at the beginning, etc. ------------------------- Rejected message (22 lines) ------------------------- 2829; Thu, 01 Apr 93 04:15:11 EST Date: Thu, 1 Apr 93 08:32:46 +0200 From: balt@shasta.Stanford.EDU (Florinel Balteanu) Subject: help From LISTSERV@GSUVM1.BITNET Sat Apr 3 03:08:16 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 4862; Sat, 3 Apr 1993 03:08:16 +0100 2843; Thu, 01 Apr 93 04:22:25 EST Date: Thu, 1 Apr 1993 04:22:24 -0500 From: Revised List Processor (1.7e) Subject: Rejected posting to NAFIPS-L@GSUVM1 Your message is being returned to you unprocessed because it looks like a LISTSERV command, rather than material you intended to post to the NAFIPS-L list. Please note that LISTSERV commands must ALWAYS be sent to the LISTSERV address; if it was indeed a command you were attempting to issue, please send it again to LISTSERV@GSUVM1 for execution. Otherwise, please accept our apologies and try to rewrite the message with a slightly different wording - possible solutions include changing the first word of the message, quoting it, inserting a line of dashes at the beginning, etc. ------------------------- Rejected message (21 lines) ------------------------- 2840; Thu, 01 Apr 93 04:20:43 EST Date: Thu, 1 Apr 93 08:36:47 +0200 From: balt@shasta.Stanford.EDU (Florinel Balteanu) Subject: help From NAFIPS-L@GSUVM1.BITNET Sat Apr 3 17:42:59 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 0509; Sat, 3 Apr 1993 17:42:53 +0100 Date: Fri, 2 Apr 1993 20:26:28 -0500 From: "Marcelo Godoy Simoes - Elec. Eng. - UT Knoxville" Subject: Re: Statistics about Who is Who in Fuzzy Marcelo Godoy Simoes University of Tennessee - USA Phone (615) 558-7552 AREA: Applications of fuzzy logic in modeling, power electronics and neural fuzzy systems. From NAFIPS-L@GSUVM1.BITNET Sat Apr 3 18:02:48 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 3888; Sat, 3 Apr 1993 18:02:40 +0100 Date: Sat, 3 Apr 1993 14:27:01 +0100 From: "Michel Eytan, LILoL" Subject: Re: Statistics about Who is Who in Fuzzy At 18:23 2/04/93 -0800, Newton Maruyama wrote: >areas: neural-fuzzy systems for modelling and control, > application of fuzzy systems to robotics. > >Newton Maruyama >Department of Engineering Science >University of Oxford >Parks Road, Oxford OX1 3PJ >tel: +44-865-273914 >fax: +44-865-273906 Reposted from the 'fuzzy mail list' (to subscribe send the usual message to listserv@vexpert.dbai.tuwien.ac.at): >----- Begin Included Message ----- > >Archives and various informative files can be found by sending the >"index" and "get" commands to listserv@vexpert.dbai.tuwien.ac.at, >see the explanations in help for full details. > >One example is the "Who is Who in Fuzzy" file that can be retrieved >by sending the command "get listserv whoiswhoinfuzzy" to >listserv@vexpert.dbai.tuwien.ac.at > >To be included in this file, send the correctly formatted entry and >all changes to Robert Fuller, e-mail: rfuller@finabo.abo.fi > >Enjoy! > >----- End Included Message ----- -- Michel Eytan, Lab Info, Log & Lang eytan@dpt-info.u-strasbg.fr Dpt Info, U Strasbourg II V: +33 88 41 74 29 22 rue Descartes, 67084 Strasbourg FR F: +33 88 41 74 40 From @europa.salford.ac.uk:A.Fraser@eee.salford.ac.uk Mon Apr 5 20:03:56 1993 Relayed; Mon, 5 Apr 1993 20:03:54 +0200 Mon, 5 Apr 1993 21:04:22 +0200 Mon, 5 Apr 1993 21:04:00 +0200 Mon, 5 Apr 1993 20:02:27 +0200 Mon, 5 Apr 1993 20:01:56 +0200 Mon, 5 Apr 1993 20:51:00 +0200 Date: Mon, 5 Apr 1993 20:51:00 +0200 From: A.Fraser@eee.salford.ac.uk Subject: Introduction Encoding: 38 TEXT Hi, Currently at the University Of Salford PhD research has led us into the realms of genetic algorithms, genetic programming and neural nets for programming our autonomous robots. The umbrella term for this work is an American term Artificial Life and for our specific work on robotics the Japanese have coined the term Evolutionary Robotics (there is a conference about this in Japan this summer). All this work is fuzzy so I hope it has some relevance. I am currently developing a UK Alife FAQ (Frequently asked questions) and had hoped to turn it into a European venture. If anyone is interested in helping with work on this FAQ which is in a very early embryonic stage I would be pleased to here from you. All help will be fully acknowledged and you will be given part authorship. Subjects covered are o Genetic Algortihms o Neural Networks o Cellular Automata o Genetic Programming o Classifier Systems and others........ Thanks in advance. Adam P. Fraser ============================================================================= || ||\\ /|| ||\\ ||\\ //\\ || A.P.Fraser, || || || \\ / || || \\ || \\ // || Snail:PostGraduate Section || || || / || || // || // // \\\ || Elec & Electronic Dept || || || || ||//\ ||//\ \\ // || University Of Salford || || || || || \\ || \\ \\// || Salford, M5 4WT, England || || ...Mobile Robots Research Group... || Email:A.Fraser@eee.salford.ac.uk || ============================================================================= |||| When we try to pick anything out by itself, we find |||| |||| it hitched to everything else in the universe. - John Muir |||| ============================================================================= From provo_b@kosmos.wcc.govt.nz Tue Apr 6 12:30:00 1993 +1200 Date: Tue, 06 Apr 1993 22:27:55 +1200 From: Bart Provo HELP SUBSCRIBE FUZZY-MAIL Bart Provo From LISTSERV@GSUVM1.BITNET Tue Apr 6 13:13:38 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 8875; Tue, 6 Apr 1993 13:13:33 +0100 2285; Tue, 06 Apr 93 07:12:28 EDT Date: Tue, 6 Apr 1993 07:12:28 -0400 From: Revised List Processor (1.7e) Subject: Rejected posting to NAFIPS-L@GSUVM1 Your message is being returned to you unprocessed because it looks like a LISTSERV command, rather than material you intended to post to the NAFIPS-L list. Please note that LISTSERV commands must ALWAYS be sent to the LISTSERV address; if it was indeed a command you were attempting to issue, please send it again to LISTSERV@GSUVM1 for execution. Otherwise, please accept our apologies and try to rewrite the message with a slightly different wording - possible solutions include changing the first word of the message, quoting it, inserting a line of dashes at the beginning, etc. ------------------------- Rejected message (22 lines) ------------------------- 2179; Tue, 06 Apr 93 07:11:42 EDT Date: Tue, 6 Apr 93 12:34:26 +0200 From: Bart Provo Subject: HELP SUBSCRIBE FUZZY-MAIL Bart Provo From NAFIPS-L@GSUVM1.BITNET Tue Apr 6 16:43:21 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 2811; Tue, 6 Apr 1993 16:43:18 +0100 Date: Tue, 6 Apr 1993 10:02:02 -0400 From: Burhan Turksen Subject: Re: Statistics about Who is Who in Fuzzy >Dear Robert, > >> The "whoiswhoinfuzzy" file contains now approximately one third of >>the total members of Fuzzy Mail. . . Please add my name to your list: Professor I. B. Turksen Department of Industrial Engineering University of Toronto Toronto, Ontario M5S 1A4 Email: turksen@ie.utoronto.ca Areas of interest are: Fuzzy Systems Modeling for control and decision-support; Interval-Valued Fuzzy sets and Logics; Uncertainty and Fuzziness. From NAFIPS-L@GSUVM1.BITNET Tue Apr 6 23:46:19 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 3159; Tue, 6 Apr 1993 23:45:21 +0100 Date: Tue, 6 Apr 1993 17:44:19 -0400 From: Dan Schwartz Subject: Who's who list Please add my name to the Who's Who list: ************************************************************************ Daniel G. Schwartz Office 904-644-5875 Dept. of Computer Science, B-173 CS Dept 904-644-2296 Florida State University Fax 904-644-0058 Tallahassee, FL 32306-4019 Home 904-385-7735 U.S.A. schwartz@cs.fsu.edu ************************************************************************ Areas of interest: Knowledge representation, methods of approximate reasoning, expert systems, case-based reasoning, information filtering and retrieval From NAFIPS-L@GSUVM1.BITNET Wed Apr 7 15:24:06 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 3303; Wed, 7 Apr 1993 15:24:00 +0100 Date: Wed, 7 Apr 1993 14:20:09 +0100 From: "Michel Eytan, LILoL" Subject: Re: Statistics about Who is Who in Fuzzy >>Dear Robert, >> >>> The "whoiswhoinfuzzy" file contains now approximately one third of >>>the total members of Fuzzy Mail. . . > Please add my name to your list: > >Professor I. B. Turksen >Department of Industrial Engineering >University of Toronto >Toronto, Ontario >M5S 1A4 > >Email: turksen@ie.utoronto.ca > >Areas of interest are: Fuzzy Systems Modeling for control and >decision-support; Interval-Valued Fuzzy sets and Logics; Uncertainty and >Fuzziness. Fellow Netters, please, PLEASE do not use the list address for this sort of message -- and *read* the welcome message that comes with your subscription to the list. On this precise point it says: >One example is the "Who is Who in Fuzzy" file that can be retrieved >by sending the command "get listserv whoiswhoinfuzzy" to >listserv@vexpert.dbai.tuwien.ac.at > >To be included in this file, send the correctly formatted entry and >all changes to Robert Fuller, e-mail: rfuller@finabo.abo.fi Thank you -- Michel Eytan, Lab Info, Log & Lang eytan@dpt-info.u-strasbg.fr Dpt Info, U Strasbourg II V: +33 88 41 74 29 22 rue Descartes, 67084 Strasbourg FR F: +33 88 41 74 40 From NAFIPS-L@GSUVM1.BITNET Wed Apr 7 23:34:25 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 2286; Wed, 7 Apr 1993 23:34:19 +0100 Date: Wed, 7 Apr 1993 14:26:04 PDT From: "Lawrence O. Hall -thru 6/1/93" Subject: NAFIPS 93 Call for Papers CALL FOR PAPERS 1993 NORTH AMERICAN FUZZY INFORMATION PROCESSING SOCIETY CONFERENCE August 22-26, 1993 The conference will be held in beautiful and historic Allentown, Pennsylvania, USA. The conference will consist of a combination of invited keynote lectures, invited state of the art plenary sessions, and related contributed paper sessions. Leading experts will provide the plenary talks. Full papers are being solicited for the contributed sessions. Relevant exhibits are also solicited. Example topics include, but are not limited to: Fuzzy sets in Computer Vision, Fuzzy databases, fuzzy control, mathematical programming, medical decision making, applications, neural networks and fuzzy artificial intelligence, fuzzy hardware, fuzzy graphs, Intelligent vehicles, approximate statistical decisions. The paper and exhibit schedule is: MAY 1, 1993 Authors submit three (3) copies of an Abstract (100 word limit), draft of paper (5 page limit) or description of proposed exhibit. MAY 15, 1993 Notification of receipt MAY 31, 1993 Decision on acceptance and mailing of instructions for preparation of camera ready manuscript or exhibit. JULY 1, 1993 Submission of camera-ready manuscript ( 5 page limit) or exhibit. All correspondence should be conducted through the general chair: Prof. Marialuisa McAllister 3604 Gloucester Drive Bethlehem, PA 18017 Phone: (215) 865-3187 FAX: (215) 861-1466 Please include full address and phone, FAX and email information on the submission. Please also place your paper in a technical area from the above choices. Special audio visual requirements should be noted. Exhibitors need to include their space requirements. Tutorials will be: 1. Basic concepts of Fuzzy sets, Fuzzy Logic and Fuzzy numbers, Marialuisa McAllister, Moravian College, PA. 2. Fuzzy Neural Computing, Madan Gupta, Univ. of Saskatchawan, Canada 3. Fuzzy Statistics, Daniel Ralescu, Univ. of Cincinnati, OH. Invited Keynote Lectures will be given by: 1. Lotfi Zadeh 2. Takeshi Yamakawa 3. Hiroyuki Watanabe State of the Art Plenary Sessions: 1. Fuzzy sets in Computer Vision, James Keller, Univ. of Missouri-Columbia 2. Fuzzy Relational Databases, Maria Zemankova, NSF 3. Fuzzy Control Theory, James Buckley, Univ. of Alabama-Birmingham 4. Fuzzy Mathematical Programming, Augustine Esogbue, Georgia Tech. 5. Fuzzy Applications to Medical Decision Making, Donna Hudson, Univ. of California, San Francisco. 6. Miscellaneous topics, Marialuisa McAllistor, Moravian College 7. Fuzzy Civil Engineering Applications, Jean-Lou Chameau Georgia Tech. 8. Fuzzy graphs, Marc Roubens, Univ. of Liege, Belgium. 9. Fuzzy neural networks and artificial intelligence, Ron Yager, Iona College 10. Fuzzy sets in Industrial Engineering, Burhan Turksen, Univ. of Toronto. 11. Fuzzy Mathematics, Sergei Ovchinnikov, San Francisco State Univ. 12. Fuzzy Memory Devices, Takeshi Yamakawa, Kyushu Institute of Technology, Japan. 13. Intelligent vehicle applications, Enrique Ruspini, SRI International, Menlo Park, CA. 14. Approximate technology for Statistical Decisions: Tailoring the analysis to fit the data, Thomas Whalen, Georgia State Univ., Atlanta, GA. From wsi@altair Fri Apr 9 17:14:19 1993 Date: Fri, 9 Apr 93 17:12:07 +0200 From: wsi@altair (Wolfgang Slany) Subject: PhD-workshop at FLAI'93: Call for Participation Call for Participation to the PhD-workshop at the FLAI'93 Eighth Austrian Artificial Intelligence Conference FLAI'93 Fuzzy Logic in Artificial Intelligence June 28, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Call for Participation "Workshop for Doctoral Students in Fuzzy-Based Systems" A workshop for about 20 PhD students from European universities to be held in conjunction with the FLAI'93 conference is proposed. This one-day-workshop is intended to enhance the personal and professional development of PhD-level students who are working in the field of fuzzy-based systems. It shall enable them to meet, to dicuss their research, and to develop their working skills. It will also serve as an introduction to the European Fuzzy-Mail-List established by Wolfgang Slany, the FLAI'93 workshop coordinator. This network enables the participants to exchange information, give help and support, and to give wider access to resources and methods. Although the network is set up and based in Europe, it is connected to the fuzzy-related list of the North American Fuzzy Information Processing Society, and will be connected to other fuzzy related elecetronic media in the future. Attendants of the workshop will be asked to either send a one-page abstract of their dissertation research or a technical position statement of particular interest to PhD students in fuzzy-based systems. The abstracts will be distributed to the workshop participants and serve as the basis for the technical discussion at the workshop. Please, send your abstract by e-mail or as paper copy to one of our adresses given at the end of this document. The workshop is intended to focus on both technical exchange of ideas among the participants and non-technical discussion of issues of particular interest to PhD students. It is planned to discuss the topic of writing a PhD thesis. This discussion will be supported by a talk of an experienced researcher in the field of fuzzy-based systems (to be named). For other topics, senior facilitators will also be invited. The general form of the workshop shall be interactive, focussing on active work in small groups and in the whole group. The workshop shall be divided into three major parts: o mutual introduction o technical program o non-technical program Each of the parts will be covered in one or more sessions over the day. The results shall be covered in a report covering the technical as well as the non-technical results of the day. Parts of the report will be written by the participants during the workshop. The report will either be published in conjunction with other FLAI'93 workshop publications or, if this is not possible, as a distinct publication. A time schedule of the workshop will be distributed later. For further questions you can contact us at the following adresses: Bernhard Moser Institute f. Computer Sciences, Salzburg University Hellbrunnerstr. 34 A-5020 Salzburg, Austria Tel: (+43)-662-8044-5318 Fax: (+43)-662-8044-5010 email: 1moser@edvz.uni-salzburg.ada.at Johann Gamper Institute f. Medical Computer Sciences, Vienna University Waehringer Guertel 18-20 A-1090 Vienna, Austria Tel: (+43)-1-40400-3494 Fax: (+43)-1-4052988 email: gamper@wiimc12.imc.univie.ac.at Sincerly - Bernhard Moser and Johann Gamper - Information on the conference, including registration material, and on how to subscribe already now to the fuzzy-mail list follows: ------------------------------------------------------------------------- Announcement and Call for Participation for a European FUZZY-MAIL-LIST An automatic mailing list (Unix-based Listserver) for all persons interested in topics related to Fuzzy Set based methods has been established. To participate, you just have to send an electronic mail containing the following two lines to listserver@vexpert.dbai.tuwien.ac.at HELP SUBSCRIBE FUZZY-MAIL Your Full Name where you replace "Your Full Name" by your real name (please do NOT specify your E-mail address here as it will be automatically extracted from the header of your mail). You will get two answers, one in response to the HELP command above, explaining other commands that you can send to listserver@vexpert.dbai.tuwien.ac.at (as for unsubscribing), plus one welcome mail in response to your SUBSCRIBE command from above. All messages sent from other participants to *************************************************************** * * * fuzzy-mail@vexpert.dbai.tuwien.ac.at * * * *************************************************************** will be forwarded to you (if you want to get your own messages for confirmation, send a SET FUZZY-MAIL MAIL ACK command after you got the confirmation of your subscription again to the address listserver@vexpert.dbai.tuwien.ac.at). Archives and various informative files can be found by sending the INDEX and GET commands to listserver@vexpert.dbai.tuwien.ac.at, see the explanations in help for full details. One example is the "Who is Who in Fuzzy" file that can be retrieved by sending the command GET LISTSERVER WHOISWHOINFUZZY to listserver@vexpert.dbai.tuwien.ac.at To be included in this file, send the correctly formatted entry and all changes directly to Robert Fuller, e-mail: rfuller@finabo.abo.fi (please do not send them to fuzzy-mail). The list has been interconnected with the NAFIPS-L mailing list of the North America Fuzzy Information Processing Society. All messages sent to one of the lists will be forwarded automatically to the other one. In the near future, I will try to interconnect this mailing list with the Fuzzy-Mailing lists from Japan and South-Korea, as well as with the fuzzy-newsgroup comp.ai.fuzzy. The reason for creating a separate European Fuzzy-Mail list is that not everybody has news-access, and traffic can be enormously reduced by links between worldwide distributors. For further questions, please get in contact with me at Wolfgang Slany Christian Doppler Labor fur Expertensysteme Institut fur Informationssysteme (Nr. 184/2) Technische Universitat Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6123 Fax: +43-1-5055304 E-mail: wsi@vexpert.dbai.tuwien.ac.at Enjoy! ------------------------------------------------------------------------- Eighth Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Call for Participation and Registration Form General Information Flai'93 will be a forum for presentation of new results in research, development and applications of Fuzzy Logic in Artificial Intelligence. The conference will favor the sharing of information between researchers and practitioners, and outline future developments of Fuzzy Logic applications in Artificial Intelligence. The conference will take place in a cozy, seminar-like atmosphere on a hill overlooking Linz. The conference language will be English for the Scientific Program and the Workshops, the Tutorials will be given in German. Program Workshops June 28, 1993 * Workshop for Doctoral Students in Fuzzy-Based Systems * Fuzzy Logic for Commercial and Industrial Applications (English/German) / Fuzzy Logic fuer Wirtschaft und Industrie (Deutsch/Englisch) * Karl Menger, Fuzzy Logic and Artificial Intelligence - An Experiment in Reflection * Fuzzy Scheduling Systems Detailed information on the workshops follows. Persons wishing to attend a workshop must register to the technical program of FLAI'93 and contact the workshop organizers. Paper contributions are welcome, please send them directly to one of the corresponding workshop organizers. Tutorials June 28, 1993 (auf Deutsch / in German) * Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH Aachen * Nachmittag: Fuzzy Control - Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig Genaue Informationen zu den Tutorials folgen. Scientific Program June 29-30, 1993 Invited Talks: * Soft Computing, Lotfi A. Zadeh, University of California, Berkeley * Contextual Approach for AI Systems Development, Irina Ezhkova, Russian Academy of Sciences, Moscow Regular Paper Sessions: * Neural Networks, Genetic Algorithms, other learning paradigms, and Fuzzy Logic * Expert Systems and Fuzzy Logic * Robotics, Control, and Fuzzy Logic * Medicine and Fuzzy Logic * Driving with Fuzzy Logic * Theoretical Issues Panels and Special Sessions: * Panel 1: FL&AI: differences and meeting points. * Panel 2: A critical view on what is going on in Fuzzy Logic and Artificial Intelligence: Hit, Hype or both? * Workshop overview session. * ESPRIT Session: The session will present the EC view on the structure and content of Fuzzy Logic or Artificial Intelligence-related projects recently accepted in the ESPRIT program. Persons interested in participating in panels or other special sessions should contact the conference chairpersons. Details on the scientific program will be sent out to you before the conference. Exhibitions June 28-30, 1993 * There will be an exhibition on recent books relevant to the conference's theme "Fuzzy Logic in Artificial Intelligence". Suggestions for books to be exhibited are welcome. * Another exhibition will display Fuzzy Logic and Artificial Intelligence related hard- and software. Companies or individuals wishing to participate should contact the organizers. Conference Organizer Oesterreichische Gesellschaft fuer Artificial Intelligence / Austrian Society for Artificial Intelligence Conference Chairpersons Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 Wolfgang Slany Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6123 Fax: +43-1-5055304 Program Committee K.-P. Adlassnig (Austria) D. Dubois (France) M. Fedrizzi (Italy) A. Geyer-Schulz (Austria/Germany) V. H. Haase (Austria) R. Kruse (Germany) R. Lopez de Mantaras (Spain) M. Reinfrank (Germany) Ph. Smets (Belgium) H. Takagi (Japan/USA) R. R. Yager (USA) M. Zemankova (USA) H.-J. Zimmermann (Germany) Workshop Organizers Rainer Born (Johannes Kepler Universitaet Linz) Johann Gamper (Universitaet Wien), Andreas Geyer-Schulz (Wirtschaftsuniversitaet Wien / Universitaet Augsburg) Roger Kerr (Technische Universitaet Wien / University of New South Wales) Peter Kotauczek (BEKO GesmbH., Wien) Bernhard Moser (Universitat Salzburg) Cooperating Institutions Fuzzy Logic Laboratorium Linz Christian Doppler Labor fuer Expertensysteme Supporting Companies and Institutions BEKO - Ing. P. Kotauczek GesmbH., Wien Technologie und Marketing GesmbH., Linz European Coordinating Committee for Artificial Intelligence ************************************************* * For a free INVITATION PROGRAM please contact: * ************************************************* by E-mail: flai93_info@vexpert.dbai.tuwien.ac.at (automatic reply with latest information), or Ms. Heidi Milos - FLAI'93 Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6125 Fax: +43-1-5055304 E-mail: flai93_secr@vexpert.dbai.tuwien.ac.at -------------------Cut-Here-For-Registration-Form------------------- REGISTRATION FORM - FLAI'93 - ANMELDUNGSFORMULAR Eighth Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Full name [] Ms. [] Mr. [] Dr. [] Prof.: Name as you would like it on your badge: Address: Telephone: Fax: E-Mail: Tutorials June 28, 1993 (auf Deutsch / in German, mit Mittagessen) [] Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH/ELITE Aachen ATS 2,000.- [] Nachmittag: Fuzzy Control-Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig ATS 2,200.- [] Ermaessigte Gebuehr fuer Teilnehmer an beiden Tutorials ATS 3,700.- Technical Program June 28-30, 1993 (including workshops, proceedings, receptions and lunches) until May 14, 1993: [] ATS 1,900.- [] Full-time student* ATS 800.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. after May 14, 1993: [] ATS 2,300.- [] Full-time student* ATS 1,000.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. [] for participants of tutorials / fuer Tutorialteilnehmer ATS 1,500.- [] OEGAI members: substract ATS 150.- (applies only once) Bed and breakfast at the conference site / Unterkunft und Fruehstueck am Tagungsort Accommodation at the conference site is ATS 500.- per night and person. Very few double rooms are available directly at the conference site. [] Please reserve [ ] single rooms [ ] double rooms Arrival date: Departure date: [] ATS 500.- x [ ] nights x [ ] persons = =====> TOTAL in Austrian Schillings (ATS) = _______________________________________________________________________ Method of Payment / Zahlungsmodus [] Transfer to bank account / Ueberweisung auf Konto [] Postal Giro account "OEGAI", no. 92,016-129, Vienna. [] Die Erste Oesterreichische Spar-Casse-Bank Wien "OEGAI", Konto-Nr. 004-71186, BLZ 20111 [] Eurocheque / Euroscheck (Please make cheque payable to "OEGAI") All cheques should be in Austrian Schillings (ATS 100.- corresponds to approximately US$ 8.55). Payment must accompany registration. In order to keep registration costs down, regretfully, credit card payments are not accepted. Please make the delegate's name clearly legible on all money transfers. [] Invoice required / Eine Rechnung wird benoetigt Date / Datum: Signature / Unterschrift: Please send your registration to / Bitte senden Sie Ihre Anmeldung an Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 SCHOLARSHIPS: Two scholarships are available for participation at FLAI'93: The Austrian Federal Ministry for Science and Research has kindly agreed to provide a limited number of scholarships covering the registration fee for the conference and part of the accommodation costs for colleagues from eastern and south-eastern European countries. The scholarships will be awarded during FLAI'93. A regular paid registration that will be refunded is necessary to apply. Application should be sent as early as possible. In cases where advance payment is not possible, please get in contact with the conference chairpersons. The organizers reserve the right to split scholarships among two or more applicants. FLAI'93 is officially sponsored by ECCAI, the European Coordinating Committee for Artificial Intelligence. Therefore members of ECCAI organizations applying to ECCAI's Travel Award fund will receive preferential treatment when applying to attend FLAI'93. Details follow in this message. ------------------------------------------------------------------------- Best regards, and see you in Linz at FLAI'93, Wolfgang SLANY FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Ms. Heidi MILOS at +43-1-5055304 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send SUBSCRIBE FUZZY-MAIL Your Real Name as a message to | | listserver@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like HELP to listserver@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From wsi@altair Sun Apr 11 11:49:52 1993 Date: Sun, 11 Apr 93 11:47:39 +0200 From: wsi@altair (Wolfgang Slany) Subject: NAFIPS-L & FUZZY-MAIL are peers (PLEASE READ THIS) Dear subscriber of either the North American Fuzzy Information Processing Society List or the European Fuzzy Distribution List, starting from now, all messages sent to one of the two lists are forwarded automatically to the other one. This ensures that all subscribers of the lists get all messages, and that they will reach all other subscribers with their own messages. NO FURTHER ACTION FROM YOU IS NECESSARY. However, should you have subscribed to both lists, you may want to unsubscribe from one to avoid getting all messages twice (information on how to unsubscribe is included at the end of this message). Additionally, please send from now on each message only to one list. There are new services available, such as the "Who is Who in Fuzzy" file (please read carefully the 3rd and 4th paragraph below on how to be included in this file): Contributions sent to both lists are automatically archived. You can obtain a list of the available archive files by sending a message to LISTSERV@GSUVM1.BITNET (for the North American Fuzzy Information Processing Society List) containing only the INDEX NAFIPS-L command in the body of the message. The files can then be retrieved by means of a GET NAFIPS-L "filetype" command, or using the database search facilities of LISTSERV. Send a message containing only the command INFO DATABASE to LISTSERV@GSUVM1.BITNET for more information on the latter. Archives and various informative files can also be found by sending the INDEX, INDEX FUZZY-MAIL, and GET FUZZY-MAIL ARCHIVE commands to listserver@vexpert.dbai.tuwien.ac.at (for the European Fuzzy Distribution List). One example is the "Who is Who in Fuzzy" file that can be retrieved by sending a message containing only the command GET LISTSERVER WHOISWHOINFUZZY in the body of the message to listserver@vexpert.dbai.tuwien.ac.at (this file was recently referred to in a mail by Robert Fuller and caused some confusion among subscribers not yet knowing how to be included in the file. We are very sorry for the disturbance caused). To be included in the "Who is Who in Fuzzy" file, send the correctly formatted entry and all changes directly to Robert Fuller, e-mail: rfuller@finabo.abo.fi (please do NOT send them to NAFIPS-L or fuzzy-mail). Those wanting to know more should send a message containing only the command HELP in the body of the message to LISTSERV@GSUVM1.BITNET (for the North American Fuzzy Information Processing Society List) and to listserver@vexpert.dbai.tuwien.ac.at (for the European Fuzzy Distribution List). The commands applicable to each listserver differ slightly since the underlying software is different. Please send all commands only to LISTSERV@GSUVM1.BITNET or listserver@vexpert.dbai.tuwien.ac.at, never to the lists themselves. If you fear an information overflow, you can choose to get a digest via fuzzy-mail once a week or when more than 1500 lines of text have accumulated, instead of each message individually. The digest also has a table of contents. This feature can be used by subscribers of fuzzy-mail by sending a message containing only the command SET FUZZY-MAIL MAIL DIGEST in the body of the message to listserver@vexpert.dbai.tuwien.ac.at Please be careful where you send your mails. ONLY if you want to send a message to all subscribers, send it either to NAFIPS-L@GSUVM1.BITNET (for the North American Fuzzy Information Processing Society List) or to fuzzy-mail@vexpert.dbai.tuwien.ac.at (for the European Fuzzy Distribution List), and please never send it to both lists. I would like to thank the following persons for spending time and effort into helping to get the two lists to become peers: Brian Schott and Evelyn Buffington as the managers of the NAFIPS-L list, who kindly agreed to peer NAFIPS-L with FUZZY-MAIL, Hideyuki Takagi for having the idea to peer the lists and for getting everybody to do something about it, Motohide Umano and Itsuo Hatono for their opinion on how to set up a worldwide list, and Anastasios Kotsikonas for his help on how to execute the set-up. We sincerely hope that this new peer setup will serve all subscribers in getting timely information on all fuzzy related matters. Best Regards, Wolfgang SLANY wsi@vexpert.dbai.tuwien.ac.at Technical University of Vienna E184/2 TEL: +43-1-58801-6123 Paniglg. 16, A-1040 Vienna, Austria FAX: +43-1-5055304 PS: How to unsubscribe? Should you have subscribed to both lists, you may want to unsubscribe from one to avoid getting all messages twice. To unsubscribe from NAFIPS-L, send a message containing only the command SIGNOFF NAFIPS-L in the body of the message to LISTSERV@GSUVM1.BITNET To unsubscribe from FUZZY-MAIL, send a message containing only the command SIGNOFF FUZZY-MAIL in the body of the message to listserver@vexpert.dbai.tuwien.ac.at PPS: Why do we need two lists instead of one? Both evolved individually, but since the focus is similar, we thought about combining them while sharing the load. There is also a Japanese mailing list (mostly in Japanese), there is a news-group named comp.ai.fuzzy, and there are others mailing lists in Asia in preparation. Each of these electronic media has its own distinctive features, so in my opinion it is best to keep them all while allowing them to share information where appropriate. From NAFIPS-L@GSUVM1.BITNET Mon Apr 12 22:01:38 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 3347; Mon, 12 Apr 1993 22:01:32 +0100 Date: Mon, 12 Apr 1993 10:23:01 PDT From: Vivian Tsou Subject: Re: Summary of Fuzzy-Neural System & Adaptive Fuzzy Control Thank you for your interest in Togai InfraLogic products and services. An information package will be sent to you. To receive information about fuzzy electronically, please send e-mail to our mail server at fuzzy-server@til.com with subject: help. You will receive an e-mail from the server describing the information available. Please feel free to contact me if you have any questions. Best Regards, -- Vivian Tsou Togai InfraLogic, Inc. (The World's Source for Fuzzy Logic Solutions) 5 Vanderbilt Irvine CA 92718 USA vivian@til.com, gordius!til!vivian, tel.(714)975-8522, fax(714)975-8524 info@til.com for info, fuzzy-server@til.com for fuzzy mail-server From PEKLUND@finabo.abo.fi Tue Apr 13 11:54:08 1993 <01GWYOQZ2V6SAH3CAT@finabo.abo.fi>; Tue, 13 Apr 1993 12:53:17 EET Date: 13 Apr 1993 12:53:17 +0200 (EET) From: PEKLUND@finabo.abo.fi Subject: MEPP93, final call for papers Mime-Version: 1.0 **************************************** **************************************** ********** M E P P '93 ************* **************************************** **************************************** International Seminar on Diagnostics and Control through Neural Interpretations of Fuzzy Sets Mariehamn, AAland, June 14-18, 1993 *** The MEPP seminars were initiated by Aldo Ventre in 1990, with the first seminar organized in Ischia, October 7-11, 1990. The seminars bring people to a discussion on efforts and consequences of bridging the gap between successful fuzzy systems applications and supporting foundational developments. A leading subtitle also for MEPP 91 and MEPP 92 was "diagnostics and control through neural interpretations of fuzzy sets", covering applications in medical diagnostics and process control. In these areas, the MEPP seminars respect engineering approaches, involving know-how and skill required for putting things to work, paradigmic approaches, focusing on development of relevant tools and techniques which support the engineering process, and foundational approaches, pinpointing relevant framework thereby guiding the development process. The MEPP 92 seminar held in Mariehamn, AAland Islands, June 15-19, 1992, drew the attention of 30 participants from Austria, Belgium, Finland, Germany, New Zealand, Norway, Russia and USA. A limited number of the Proceedings of MEPP 92 are still available. Send requests to peklund@finabo.abo.fi. *** Program Committee Miguel Delgado, Spain Patrik Eklund, Finland, chairman Mario Fedrizzi, Italy Jari Forsstroem, Finland Robert Fuller, Hungary Frank Klawonn, Germany Peter Klement, Austria Aldo Ventre, Italy Jose Verdegay, Spain Ron Yager, USA The forthcoming seminar will continue focusing on paradigms for inference with topics including + structures of fuzzy sets + basic concepts and tools + fuzzy logic + neural fuzzy systems + diagnostics and control + medical applications + decision support Authors are invited to submit papers for the conference. Extended abstracts must not exceed 10 pages, and should be received before April 30, 1993. For more information, please contact Patrik Eklund Abo Akademi University Department of Computer Science Lemminkainengatan 14 SF-20520 ABO Finland fax +358-21-654732 phone +358-21-654684 (654475) e-mail peklund@finabo.abo.fi *** Seminar site is Hotel Arkipelag in Mariehamn, capital of AAland. The islands are located between the Finnish and Swedish mainlands. An opening session will be held on Monday, June 14, on M/S Amorella (from Abo/Turku to Mariehamn). A post-seminar discussion will be arranged on Friday afternoon, June 18, on M/S Kalypso (Mariehamn to Abo). You can reach Mariehamn by + direct flights from Abo, Helsinki and Stockholm + ferries from Abo and Stockholm Participants are recommended to arrive in and depart from Abo, thus joining us for the opening and closing session on the luxurious ferries in our beautiful Aland archipelago. If you intend to participate, please return the non-binding pre-registration form as soon as possible. *** PRELIMINARY REGISTRATION Name: _____________________________________________ Organization: _______________________________________ Address: ___________________________________________ ____________________________________________________ Fax: ____________ E-mail: _________________________ Title of abstract: _____________________________________ ____________________________________________________ Estimated arrival In: ____________________ Date: __________________ Estimated departure From: ____________________ Date: __________________ Registration fee: 1.000 FIM , including - ferry trips - conferences lunches and coffee breaks - conference dinner - preceedings Accomodation (please mark your choices): MARIEHAMN: At Hotel Arkipelag, a conference hotel in the center of Mariehamn, single rooms are available at the price of 400 FIM/night (incl breakfast and morning sauna). [ ] "standardized" using the ferries, 4 nights from June 14 to 18 [ ] ___ nights arriving June ___, departing June ____. ABO: At Hotel Keskushotelli, in the center of Abo, rooms are available at the price of 200 FIM/night (incl breakfast). [ ] ___ nights, specify dates (if not according to arrival in and departure from Abo): From NAFIPS-L@GSUVM1.BITNET Tue Apr 13 15:41:41 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 5251; Tue, 13 Apr 1993 15:41:00 +0100 Date: Tue, 13 Apr 1993 09:37:08 EDT From: Cliff Joslyn Subject: Re: PhD-workshop at FLAI'93: Call for Papers & Participation In-Reply-To: <6424@vexpert.dbai.tuwien.ac.at> This is a cross-post from comp.ai.fuzzy. The PhD workshop in particular is a great idea, and something that would benefit me directly (in job-hunting?). Any hope of getting something like this going in America, perhaps at NAFIPS '93? I'd help... O-----------------------------------------------------------------------------> | Cliff Joslyn, Cybernetician at Large, 327 Spring St #2 Portland ME 04102 USA | Systems Science, SUNY Binghamton NASA Goddard Space Flight Center | cjoslyn@bingsuns.cc.binghamton.edu joslyn@kong.gsfc.nasa.gov V All the world is biscuit shaped. . . In article <6424@vexpert.dbai.tuwien.ac.at> you write: > > Call for Papers & Participation to the PhD-workshop at the FLAI'93 > > > Eighth Austrian Artificial Intelligence Conference > > FLAI'93 > Fuzzy Logic in Artificial Intelligence > > June 28, 1993 > Bildungszentrum St. Magdalena, Linz, Austria (Europe) > > > Call for Participation > > "Workshop for Doctoral Students in Fuzzy-Based Systems" > >A workshop for about 20 PhD students from European universities to be >held in conjunction with the FLAI'93 conference is proposed. This >one-day-workshop is intended to enhance the personal and professional >development of PhD-level students who are working in the field of >fuzzy-based systems. It shall enable them to meet, to dicuss their >research, and to develop their working skills. It will also serve as >an introduction to the European Fuzzy-Mail-List established by >Wolfgang Slany, the FLAI'93 workshop coordinator. This network enables >the participants to exchange information, give help and support, and >to give wider access to resources and methods. Although the network is >set up and based in Europe, it is connected to the fuzzy-related list >of the North American Fuzzy Information Processing Society, and will >be connected to other fuzzy related elecetronic media in the future. > >Attendants of the workshop will be asked to either send a one-page >abstract of their dissertation research or a technical position >statement of particular interest to PhD students in fuzzy-based >systems. The abstracts will be distributed to the workshop >participants and serve as the basis for the technical discussion at >the workshop. Please, send your abstract by e-mail or as paper copy >to one of our adresses given at the end of this document. > >The workshop is intended to focus on both technical exchange of ideas >among the participants and non-technical discussion of issues of >particular interest to PhD students. It is planned to discuss the >topic of writing a PhD thesis. This discussion will be supported by a >talk of an experienced researcher in the field of fuzzy-based systems >(to be named). For other topics, senior facilitators will also be >invited. > >The general form of the workshop shall be interactive, focussing on >active work in small groups and in the whole group. The workshop >shall be divided into three major parts: > > o mutual introduction > > o technical program > > o non-technical program > >Each of the parts will be covered in one or more sessions over the >day. The results shall be covered in a report covering the technical >as well as the non-technical results of the day. Parts of the report >will be written by the participants during the workshop. The report >will either be published in conjunction with other FLAI'93 workshop >publications or, if this is not possible, as a distinct publication. > >A time schedule of the workshop will be distributed later. > >For further questions you can contact us at the following adresses: > >Bernhard Moser >Institute f. Computer Sciences, Salzburg University >Hellbrunnerstr. 34 >A-5020 Salzburg, Austria >Tel: (+43)-662-8044-5318 >Fax: (+43)-662-8044-5010 >email: 1moser@edvz.uni-salzburg.ada.at > >Johann Gamper >Institute f. Medical Computer Sciences, Vienna University >Waehringer Guertel 18-20 >A-1090 Vienna, Austria >Tel: (+43)-1-40400-3494 >Fax: (+43)-1-4052988 >email: gamper@wiimc12.imc.univie.ac.at > >Sincerly > - Bernhard Moser and Johann Gamper - > >Information on the conference, including registration material, and on >how to subscribe already now to the fuzzy-mail list follows: > >------------------------------------------------------------------------- > > > Announcement and Call for Participation for a European > > FUZZY-MAIL-LIST > > >An automatic mailing list (Unix-based Listserver) for all persons >interested in topics related to Fuzzy Set based methods has been >established. To participate, you just have to send an electronic mail >containing the following two lines to >listserver@vexpert.dbai.tuwien.ac.at > >HELP >SUBSCRIBE FUZZY-MAIL Your Full Name > >where you replace "Your Full Name" by your real name (please do NOT >specify your E-mail address here as it will be automatically extracted >from the header of your mail). You will get two answers, one in >response to the HELP command above, explaining other commands that you >can send to listserver@vexpert.dbai.tuwien.ac.at (as for unsubscribing), >plus one welcome mail in response to your SUBSCRIBE command from >above. All messages sent from other participants to > > > *************************************************************** > * * > * fuzzy-mail@vexpert.dbai.tuwien.ac.at * > * * > *************************************************************** > >will be forwarded to you (if you want to get your own messages for >confirmation, send a > >SET FUZZY-MAIL MAIL ACK > >command after you got the confirmation of your subscription again to >the address listserver@vexpert.dbai.tuwien.ac.at). > >Archives and various informative files can be found by sending the >INDEX and GET commands to listserver@vexpert.dbai.tuwien.ac.at, >see the explanations in help for full details. > >One example is the "Who is Who in Fuzzy" file that can be retrieved >by sending the command GET LISTSERVER WHOISWHOINFUZZY to >listserver@vexpert.dbai.tuwien.ac.at > >To be included in this file, send the correctly formatted entry and >all changes directly to Robert Fuller, e-mail: rfuller@finabo.abo.fi >(please do not send them to fuzzy-mail). > >The list has been interconnected with the NAFIPS-L mailing list of the >North America Fuzzy Information Processing Society. All messages sent >to one of the lists will be forwarded automatically to the other one. > >In the near future, I will try to interconnect this mailing list with >the Fuzzy-Mailing lists from Japan and South-Korea, as well as with >the fuzzy-newsgroup comp.ai.fuzzy. The reason for creating a separate >European Fuzzy-Mail list is that not everybody has news-access, and >traffic can be enormously reduced by links between worldwide >distributors. For further questions, please get in contact with me at > > Wolfgang Slany > Christian Doppler Labor fur Expertensysteme > Institut fur Informationssysteme (Nr. 184/2) > Technische Universitat Wien > Paniglg. 16, A-1040 Vienna, Austria (Europe) > Tel: +43-1-58801-6123 > Fax: +43-1-5055304 > E-mail: wsi@vexpert.dbai.tuwien.ac.at > >Enjoy! > > >------------------------------------------------------------------------- > > > Eighth Austrian Artificial Intelligence Conference > > FLAI'93 > > FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE > > June 28-30, 1993 > Bildungszentrum St. Magdalena, Linz, Austria (Europe) > > > Call for Participation and Registration Form > > > General Information > >Flai'93 will be a forum for presentation of new results in research, >development and applications of Fuzzy Logic in Artificial >Intelligence. The conference will favor the sharing of information >between researchers and practitioners, and outline future developments >of Fuzzy Logic applications in Artificial Intelligence. The conference >will take place in a cozy, seminar-like atmosphere on a hill >overlooking Linz. The conference language will be English for the >Scientific Program and the Workshops, the Tutorials will be given in >German. > > Program > >Workshops June 28, 1993 > > * Workshop for Doctoral Students in Fuzzy-Based Systems > * Fuzzy Logic for Commercial and Industrial Applications (English/German) / > Fuzzy Logic fuer Wirtschaft und Industrie (Deutsch/Englisch) > * Karl Menger, Fuzzy Logic and Artificial Intelligence - > An Experiment in Reflection > * Fuzzy Scheduling Systems > > Detailed information on the workshops follows. > Persons wishing to attend a workshop must register to the technical > program of FLAI'93 and contact the workshop organizers. Paper > contributions are welcome, please send them directly to one of the > corresponding workshop organizers. > >Tutorials June 28, 1993 (auf Deutsch / in German) > > * Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in > Expertensystemen) > Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH Aachen > * Nachmittag: Fuzzy Control - Grundlagen > (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, > Teubner Verlag, 1993") > Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig > > Genaue Informationen zu den Tutorials folgen. > >Scientific Program June 29-30, 1993 > >Invited Talks: > > * Soft Computing, > Lotfi A. Zadeh, University of California, Berkeley > * Contextual Approach for AI Systems Development, > Irina Ezhkova, Russian Academy of Sciences, Moscow > >Regular Paper Sessions: > > * Neural Networks, Genetic Algorithms, other learning paradigms, > and Fuzzy Logic > * Expert Systems and Fuzzy Logic > * Robotics, Control, and Fuzzy Logic > * Medicine and Fuzzy Logic > * Driving with Fuzzy Logic > * Theoretical Issues > >Panels and Special Sessions: > > * Panel 1: FL&AI: differences and meeting points. > * Panel 2: A critical view on what is going on in Fuzzy Logic > and Artificial Intelligence: Hit, Hype or both? > * Workshop overview session. > * ESPRIT Session: The session will present the EC view on the > structure and content of Fuzzy Logic or Artificial > Intelligence-related projects recently accepted in the ESPRIT > program. > > Persons interested in participating in panels or other special > sessions should contact the conference chairpersons. > > Details on the scientific program will be sent out to you before the > conference. > >Exhibitions June 28-30, 1993 > > * There will be an exhibition on recent books relevant to the > conference's theme "Fuzzy Logic in Artificial Intelligence". > Suggestions for books to be exhibited are welcome. > * Another exhibition will display Fuzzy Logic and Artificial > Intelligence related hard- and software. Companies or individuals > wishing to participate should contact the organizers. > > > Conference Organizer >Oesterreichische Gesellschaft fuer Artificial Intelligence / >Austrian Society for Artificial Intelligence > > Conference Chairpersons > Erich Peter Klement > Fuzzy Logic Laboratorium Linz > Institut fuer Mathematik > Johannes Kepler Universitaet > A-4040 Linz, Austria (Europe) > Tel: +43-732-2468-9151 Fax: +43-732-2468-10 > > Wolfgang Slany > Christian Doppler Labor fuer Expertensysteme > Institut fuer Informationssysteme (Nr. 184/2) > Technische Universitaet Wien > Paniglg. 16, A-1040 Vienna, Austria (Europe) > Tel: +43-1-58801-6123 Fax: +43-1-5055304 > > Program Committee > K.-P. Adlassnig (Austria) D. Dubois (France) > M. Fedrizzi (Italy) A. Geyer-Schulz (Austria/Germany) > V. H. Haase (Austria) R. Kruse (Germany) > R. Lopez de Mantaras (Spain) M. Reinfrank (Germany) > Ph. Smets (Belgium) H. Takagi (Japan/USA) > R. R. Yager (USA) M. Zemankova (USA) > H.-J. Zimmermann (Germany) > > Workshop Organizers >Rainer Born (Johannes Kepler Universitaet Linz) >Johann Gamper (Universitaet Wien), >Andreas Geyer-Schulz (Wirtschaftsuniversitaet Wien / Universitaet Augsburg) >Roger Kerr (Technische Universitaet Wien / University of New South Wales) >Peter Kotauczek (BEKO GesmbH., Wien) >Bernhard Moser (Universitat Salzburg) > > Cooperating Institutions >Fuzzy Logic Laboratorium Linz >Christian Doppler Labor fuer Expertensysteme > > Supporting Companies and Institutions >BEKO - Ing. P. Kotauczek GesmbH., Wien >Technologie und Marketing GesmbH., Linz >European Coordinating Committee for Artificial Intelligence > > ************************************************* > * For a free INVITATION PROGRAM please contact: * > ************************************************* > >by E-mail: flai93_info@vexpert.dbai.tuwien.ac.at >(automatic reply with latest information), or > >Ms. Heidi Milos - FLAI'93 >Christian Doppler Labor fuer Expertensysteme >Institut fuer Informationssysteme (Nr. 184/2) >Technische Universitaet Wien >Paniglg. 16, A-1040 Vienna, Austria (Europe) >Tel: +43-1-58801-6125 >Fax: +43-1-5055304 >E-mail: flai93_secr@vexpert.dbai.tuwien.ac.at > > > >-------------------Cut-Here-For-Registration-Form------------------- > > > REGISTRATION FORM - FLAI'93 - ANMELDUNGSFORMULAR > > Eighth Austrian Artificial Intelligence Conference > > FLAI'93 > > FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE > > June 28-30, 1993 > Bildungszentrum St. Magdalena, Linz, Austria (Europe) > > >Full name [] Ms. [] Mr. [] Dr. [] Prof.: >Name as you would like it on your badge: >Address: > > > >Telephone: >Fax: >E-Mail: > > > Tutorials June 28, 1993 > (auf Deutsch / in German, mit Mittagessen) > >[] Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in > Expertensystemen) > Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH/ELITE Aachen > ATS 2,000.- > >[] Nachmittag: Fuzzy Control-Grundlagen > (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") > Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig > ATS 2,200.- > >[] Ermaessigte Gebuehr fuer Teilnehmer an beiden Tutorials > ATS 3,700.- > > > Technical Program June 28-30, 1993 > (including workshops, proceedings, receptions and lunches) > >until May 14, 1993: [] ATS 1,900.- > [] Full-time student* ATS 800.- >* A copy of a picture student identification card or an official >letter from the university indicating full-time student status and age >(up to 29 years old) must accompany this registration form. > >after May 14, 1993: [] ATS 2,300.- > [] Full-time student* ATS 1,000.- >* A copy of a picture student identification card or an official >letter from the university indicating full-time student status and age >(up to 29 years old) must accompany this registration form. > >[] for participants of tutorials / fuer Tutorialteilnehmer > ATS 1,500.- > >[] OEGAI members: substract ATS 150.- (applies only once) > > > Bed and breakfast at the conference site / > Unterkunft und Fruehstueck am Tagungsort > >Accommodation at the conference site is ATS 500.- per night and >person. Very few double rooms are available directly at the conference >site. > >[] Please reserve [ ] single rooms > [ ] double rooms > Arrival date: > Departure date: > >[] ATS 500.- x [ ] nights x [ ] persons = > >=====> TOTAL in Austrian Schillings (ATS) = >_______________________________________________________________________ > > > Method of Payment / Zahlungsmodus > >[] Transfer to bank account / Ueberweisung auf Konto > > [] Postal Giro account "OEGAI", no. 92,016-129, Vienna. > > [] Die Erste Oesterreichische Spar-Casse-Bank Wien > "OEGAI", Konto-Nr. 004-71186, BLZ 20111 > >[] Eurocheque / Euroscheck (Please make cheque payable to "OEGAI") > >All cheques should be in Austrian Schillings (ATS 100.- corresponds to >approximately US$ 8.55). Payment must accompany registration. In order >to keep registration costs down, regretfully, credit card payments are >not accepted. Please make the delegate's name clearly legible on all >money transfers. > >[] Invoice required / Eine Rechnung wird benoetigt > >Date / Datum: > > > >Signature / Unterschrift: > >Please send your registration to / Bitte senden Sie Ihre Anmeldung an > > Erich Peter Klement > Fuzzy Logic Laboratorium Linz > Institut fuer Mathematik > Johannes Kepler Universitaet > A-4040 Linz, Austria (Europe) > Tel: +43-732-2468-9151 Fax: +43-732-2468-10 > >SCHOLARSHIPS: Two scholarships are available for participation at FLAI'93: > >The Austrian Federal Ministry for Science and Research has kindly >agreed to provide a limited number of scholarships covering the >registration fee for the conference and part of the accommodation >costs for colleagues from eastern and south-eastern European >countries. The scholarships will be awarded during FLAI'93. A regular >paid registration that will be refunded is necessary to apply. >Application should be sent as early as possible. In cases where >advance payment is not possible, please get in contact with the >conference chairpersons. The organizers reserve the right to split >scholarships among two or more applicants. > >FLAI'93 is officially sponsored by ECCAI, the European Coordinating >Committee for Artificial Intelligence. Therefore members of ECCAI >organizations applying to ECCAI's Travel Award fund will receive >preferential treatment when applying to attend FLAI'93. Details follow >in this message. > >------------------------------------------------------------------------- > >Best regards, and see you in Linz at FLAI'93, > >Wolfgang SLANY > >FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 >Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at >Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at >Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at >or fax to Ms. Heidi MILOS at +43-1-5055304 > > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ >| Send SUBSCRIBE FUZZY-MAIL Your Real Name as a message to | >| listserver@vexpert.dbai.tuwien.ac.at to subscribe to the European | >| fuzzy-mail list. Send all messages that you want to be distributed to | >| the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | >| control commands like HELP to listserver@vexpert.dbai.tuwien.ac.at | > ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ > > From zizka@dame.fee.vutbr.cs Tue Apr 13 16:32:31 1993 13 Apr 93 16:32 MEST Date: Tue, 13 Apr 1993 16:03:48 +0200 (MET DST) From: Jan Zizka Subject: Looking for defuzzification hints Mime-Version: 1.0 Could anybody please send me any hints or references having to do with defuzzification methods other than pure gravity centers or points of maximum? I am interested in combining both methods mentioned above, as well as in computing weighted gravity centers. I would also like to compare different ways for different cases and application areas. (I cannot employ linguistic methods, e.g., those ones based on test-score semantics). Thanks a lot, Jan Zizka zizka@dame.fee.vutbr.cs Dept. of Automation and Measurement Eng. Faculty of Electrical Eng. Brno Technical University Bozetechova 2 612 66 Brno Czech Republic From NAFIPS-L@GSUVM1.BITNET Tue Apr 13 17:46:40 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 8305; Tue, 13 Apr 1993 17:46:32 +0100 Date: Tue, 13 Apr 1993 17:40:08 +0200 From: Thomas Runkler Subject: Re: Looking for defuzzification hints On April 13, 1993, Jan Ziska wrote: > Could anybody please send me any hints or references > having to do with defuzzification methods other than > pure gravity centers or points of maximum? Here are some references well considered: @ARTICLE{Fil91, AUTHOR = {D. P. Filev and R. R. Yager}, TITLE = {{A Generalized Defuzzification Method via Bad Distributions}}, JOURNAL = {International Journal of Intelligent Systems}, VOLUME = {6}, PAGES = {687--697}, YEAR = {1991} } @INPROCEEDINGS{Hel93, AUTHOR = {H. Hellendoorn}, TITLE = {{Design and Development of Fuzzy Systems at Siemens R\&D}}, BOOKTITLE = {Second IEEE International Conference on Fuzzy Systems}, PAGES = {1365--1370}, ADDRESS = {San Francisco}, MONTH = {March/April}, YEAR = {1993} } @ARTICLE{Lee90II, AUTHOR = {C. C. Lee}, TITLE = {{Fuzzy Logic in Control Systems: Fuzzy Logic Controller --- Part II}}, JOURNAL = {IEEE Transactions on Systems, Man and Cybernetics}, VOLUME = {20}, NUMBER = {2}, PAGES = {419--435}, MONTH = {March/April} YEAR = {1990} } @INPROCEEDINGS{Miz89, AUTHOR = {M. Mizumoto}, TITLE = {{Improvement Methods of Fuzzy Controls}}, BOOKTITLE = {3rd IFSA Congress}, PAGES = {60--62}, YEAR = {1989} } @INPROCEEDINGS{Pfl92, AUTHOR = {N. Pfluger and J. Yen and R. Langari}, TITLE = {{A Defuzzification Strategy for a Fuzzy Logic Controller Employing Prohibitive Information in Command Formulation}}, BOOKTITLE = {IEEE International Conference on Fuzzy Systems}, PAGES = {717--723}, YEAR = {1992} } @INPROCEEDINGS{Run93a, AUTHOR = {T. A. Runkler and M. Glesner}, TITLE = {{A Set of Axioms for Defuzzification Strategies --- Towards a Theory of Rational Defuzzification Operators}}, BOOKTITLE = {Second IEEE International Conference on Fuzzy Systems}, PAGES = {1161--1166}, ADDRESS = {San Francisco}, MONTH = {March/April}, YEAR = {1993} } @INPROCEEDINGS{Yag92, AUTHOR = {R. R. Yager}, TITLE = {{Fuzzy Sets and Approximate Reasoning in Decision and Control}}, BOOKTITLE = {IEEE International Conference on Fuzzy Systems}, PAGES = {418--428}, YEAR = {1992} } Please summarize! Best regards - Thomas A Runkler ------------------------------------------------------------------------------ Thomas A Runkler Darmstadt University of Technology Institute of Microelectronic Systems Karlstrasse 15 Tel. (+49)6151 16 4337 D-6100 Darmstadt Fax (+49)6151 16 4936 GERMANY Email thomasr@microelectronic.e-technik.th-darmstadt.de ------------------------------------------------------------------------------ From stohl@vai.co.at Wed Apr 14 17:12:24 1993 (5.65c8/hp4at for fuzzy-mail@vexpert.dbai.tuwien.ac.at); Wed, 14 Apr 1993 11:12:25 -0400 Date: Wed, 14 Apr 93 16:07:46 +0200 From: stohl@vai.co.at (Stohl Klaus BG48 413 3631) Subject: information exchange using fuzzyTECH Klaus Stohl =========== VOEST-Alpine Industrieanlagenbau GmbH. Dept.: TAP1 A-4031 Linz, Turmstr. 44 Phone: +43-732-592-3631 Fax: +43-732-592-2089 Email: stohl@vai.co.at Hi everybody in the net, I am currently working with fuzzyTECH, the tool of INFORM. I look for people, who also use this tool and are interested in exchanging information. Klaus Stohl From NAFIPS-L@GSUVM1.BITNET Wed Apr 14 18:13:29 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 6041; Wed, 14 Apr 1993 18:13:21 +0100 Date: Wed, 14 Apr 1993 09:54:33 EST From: "Ronald R. Yager" Subject: Looking for defuzzification hints In-Reply-To: In reply to your message of TUE 13 APR 1993 09:39:26 EST REGARDING the ISSUE OF DEFUZZIFICATION TECHNIQUES We have a number of papers suggesting alternative techniques for defuzzification. You can obtain these by contacting us at Ronald R. Yager Machine Intelligence Institute Iona College New Rochelle, NY 10801 USA e-mail: RRY1@Iona.bitnet From RFULLER@finabo.abo.fi Thu Apr 15 12:03:32 1993 <01GX1HN8LN4GAH44DH@finabo.abo.fi>; Thu, 15 Apr 1993 13:02:48 EET Date: 15 Apr 1993 13:02:45 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Fuzzy Publications from Hungary Mime-Version: 1.0 Fuzzy Publications from Hungary (FPH) Dear Colleagues, Enclosed you can find a (not complete) list of publications on Fuzzy Sets and Systems written by the members of the Hungarian Fuzzy Community. We distribute this list through Fuzzy-Mail, because it makes easier to exchange publications and, which is more important, can assist in creating new scientific cooperations. If you need some reprints then please contact directly the author(s). We are looking forward to cooperate with you. The contributors (in alphabetical order): Jozsef Dombi (Research Group on the Theory of Automata, Hungarian Academy of Science, 6720 Szeged Aradi V. t. 1., phone: 36-62-311622, fax: 36-62-312508, email: h159dom@ella.hu) is interested in -operations on fuzzysets, (axiomatic approach, conjunctive- disjunctive operators, t-norm, t-conorm, implications; relations between the operators). -modeling multicriteria decision making; utility theory, problem of weighting, preference relations, aggregation and weighted average, -membership function -linguistic hedges -using neuron networks -fuzzy regression procedures. He is a member of IFSA and worked with H.J. Zimmermann in Aachen from 1979-1980 in the framework of the German Academic Exchange Service and from 1976-1978 getting the Alexander Humboldt fellowship. He work also together with J. Baldwin in University of Bristol, Artificial Intelligence Group. Janos C.Fodor (Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Budapest, phone: 36-1-1869066, fax: 36-1-1811-976, e-mail: h1367fod@huella.bitnet and cfodor@granada.elte.hu) is active in the following topics: - operations on fuzzy sets, (basic theoretical questions of t-norms, weak t-norms and fuzzy implications) - fuzzy relations, (axiomatic approach to fuzzy preference modeling; different kinds of orders; traces of fuzzy binary relations) - using fuzzy preference modeling in multicriteria decision making problems, (aggregation of preferences, comparison of pre- and post-choice methods; ranking by scoring; consensus via aggregation of decomposable measures) He spent three months at the University of Liege in 1991, with financial assistance from PEREGRINATIO II Foundation. He has been doing reserach with M.Roubens since 1989. They are preparing a book on aggregation, choice and scoring procedure in MCDM problems. Robert Fuller (Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-1811-976, e-mails: rfuller@cs.elte.hu, fuller@cs.unitn.it, rfuller@finabo.abo.fi) is interested in - using fuzzy reasoning techniques for solving fuzzy mathematical programming problems, - linear and nonlinear systems with fuzzy numbers, t-norm-based-operations on fuzzy sets, - fuzzy control, - neuro-fuzzy techniques for medical diagnostics He is a member of the IFSA, the American Mathematical Society, Deutsche Gesellschaft fur Operations Research and worked with H.-J.Zimmermann in Aachen from 1990 to 1991 in the framework of the German Academic Exchange Service, and has been a visiting researcher at Abo Akademi University in Finland. He is the head of the project titled "Management of Uncertainty and Imprecision in Knowledge-Based Systems: the Fuzzy Approach" sponsored by the Hungarian Research Foundation under the contract OTKA T 4281. Lajos Gergo (Department of Numerical Analysis, Eotvos Lorand University, P.O.Box 157, H-1502 Budapest, e-mail: H1592Ger@huella.bitnet) is interested in - topological properties of fuzzy numbers and the investigation of metric spaces of normal, fuzzy convex, upper-semicontinuous, compactly supported fuzzy numbers on R^n and embedding theorems of metric spaces of fuzzy numbers. His further goal is to solve certain problems of fuzzy numerical analysis, e.g. fuzzy differential equations and least squares approximation. Tibor Keresztfalvi (Department of Applied Analysis, Eotvos Lorand University, e-mail: xtibor@ludens.elte.hu) investigates - t-norm-based operations on fuzzy intervals, - extended functions (defined via a sup-t-norm convolution), - fuzzy (multiobjective) mathematical programming problems under t-norms, - exact calculation formulas in fuzzy logic. He worked with H.Rommelfanger in Frankfurt from 1990 to 1991 in the framework of the German Academic Exchange Service (DAAD) and presently is a DFG researcher at University of Frankfurt (Institut fur Statistik and Mathematik, University of Frankfurt, Mertonstrasse 17-25, W-6000 Frankfurt am Main, fax: 49-69-7983330, e-mail: keresztfalvi@wiwi.uni-frankfurt.dbp.de). Attila Kiss (Department of Applied Computer Science, Eotvos Lorand University, e-mail: kiss@palma1.elte.hu) investigates: - classical and fuzzy relational database theory, (investigation of dependencies of databases, the implication problem of dependencies and the application of the classical decision and proof procedures to fuzzy relational databases) - generalization of dependencies to the case of fuzzy relations using the first or higher order logic in order to develop some means that help to perform the normalization of databases, - the DATALOG extensions to fuzzy relations, - the problem: how the information stored in fuzzy databases can be measured? Laszlo T. Koczy (Department of Telecommunication and Telematics, Technical University of Budapest, Fax: +361-1812-302 or +361-1666-808, h1256koc@ella.hu or h1256@huella.bitnet) is active in the fields - algorithms of fuzzy rule based control (complexity, interpolation, extrapolation, general approximation of rules) - certain aspects of computer vision by fuzzy methods (edge detection, components positions, etc.) - fuzzy hardware components (flip-flops, various circuits) - fuzzy graphs - properties of strictly monotonous norms and corresponding algebraic structures He started fuzzy research in 1973 at the Technical University. In 1990, he spent a short period in Dalian, China, as visiting professor, lecturing Fuzzy sets and applications. In 1992, he spent 6 months in Pohang, Korea, lecturing Fuzzy logic and applications. For 1993/94 he has the invitation for the LIFE Chair of Fuzzy Theory, Tokyo, Japan. Margit Kovacs (Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869066, fax: 36-1-1811-976, e-mail: margo@cs.elte.hu) deals with mathematical programming under uncertainty, first of all with ill-posed and fuzzy problems. She is mainly interested in - theoretical foundation and comparison of fuzzy optimality concepts, multiobjective linear programming, - stability properties of the solution of fuzzy optimization problems and searching for relationships between classical - regularization methods and fuzzification, solution of fuzzy linear systems and fuzzy linear model fitting, - economical and technical applications of fuzzy theory, - approximate reasoning for optimization. She was the chairperson of the Organizing Committee of the 3rd joint IFSA-EC and EURO-WG workshop on fuzzy sets, and head of the project entitled "Fuzzy Decision Analysis" supported by the Hungarian Research Foundation under the contract OTKA I/3-2152. 149 Publications on Fuzzy Sets and Systems from Hungary J.Dombi J.Dombi, Membership function as an evaluation, Fuzzy Sets and Systems, 35(1990)1-21. J.Dombi, A general class of fuzzy operators, the DeMorgan class of fuzzy operators and fuziness measures induced by fuzzy operators, Fuzzy Sets and Systems, 8(1982) 149-163. J.Dombi, Basic concepts for a theory of evaluation: The aggregative operator, European Journal of Operational Research, 10(1982) 282-293. J.Dombi and P.Zysno, Comments on the \gamma-model, Cybernetics and Systems Research, R.Trappl ed., North-Holland, 1982 711-714. J.Dombi, Basic concepts for a theory of evaluation: The aggregative operator, European Journal of Operational Research, 10(1982) 282-293. T. Gyimothy, J. Dombi, Syntactic pattern recognition with modified fuzzy automata, Computer linguistics and Computer languages 15, 1982 175-193. J. Dombi, Evaluation theory and literary theory, in Studia Poetica 4 ed. Z. Kanyo 1982 343-356. J. Dombi, Z. Vas: Basic theoretical treatment of fuzzy connectives, Acta Cybernetica 6, 1983 191-201. T. Solymosi, J. Dombi: A method for determining the weights of criteria: the centralized weights, European Journal of Operational Research 26, 1986 35-41. J. Dombi, Properties of the fuzzy connectives in the light of general representation theory, Acta Cybernetica 7, 1986 313-321. Z. Alexin, J. Dombi, K. Fabricz, T. Gyimothy, T. Horvath, Constructor: A natural language interface based on attribute grammar, Acta Cybernetica 9, 1990 247-256. J. Dombi, Cezary Iwanski, Rational, not strictly monotonous logic operators, Control and Cybernetics 18, 1989 179-190. J. Dombi, L. Porkolab, Measures of fuzziness, Annales Univ. Sci 12, 1991 69-78. T. Solymosi, J. Dombi, Fitting functions to data with error bounds: fuzzy regression with ERRGO, in Fuzzy Regression Analysis, ed. J. Kacprzyk, M. Fedrizzi, Omnitech Press Warsaw and Springer-Verlag Company 1993 101-115. Janos C.Fodor J.C. Fodor, Elements of fuzzy convexity in linear spaces,BUSEFAL 33 (1987) 62--71. (Zbl 665.15004) J.C. Fodor, A method to construct t-norms, BUSEFAL 35 (1988) 48--52. J.C. Fodor, t-norms and generalized copulas, BUSEFAL 36 (1988) 4--7. J.C. Fodor, On inclusion and equality of fuzzy sets, in: A. Ivanyi, Ed., Proc. of 4th Conf. of Program Designers ELTE, Budapest, 1988, 249--254. J.C. Fodor, Some remarks on default reasoning, in: A.Ivanyi, Ed., Proc. of 5th Conf. of Program Designers, ELTE, Budapest, 1989, 171--176. J.C. Fodor, Some remarks on fuzzy implication operators, BUSEFAL 38 (1989) 42--46. J.C. Fodor, Some results on weak t-norms, BUSEFAL 42 (1990) 7--11. J.C. Fodor, Some results on fuzzy binary relations via their traces, BUSEFAL 45 (1990/91) 52--53. J.C. Fodor, Aggregation of preferences --- an axiomatic approach with applications, Annales Univ. Sci. Budapest., Sectio Computatorica 12 (1991) 86--92. J.C. Fodor and M. Roubens, Fuzzy preference modelling: an overview, Annales Univ. Sci. Budapest., Sectio Computatoric 12 (1991) 93--100. J.C. Fodor, A remark on constructing t-norms, Fuzzy Sets and Systems 41 (1991) 195--199. (MR 92d:04002) J.C. Fodor, On fuzzy implication operators, Fuzzy sets and Systems 42 (1991) 293--300. (MR 92g:03038) J.C. Fodor, Strict preference relations based on weak t-norms, Fuzzy Sets and Systems 43 (1991) 327--336. J.C. Fodor, Traces of fuzzy binary relations, Fuzzy Sets and Systems 50 (1992) 331--342. J.C. Fodor, An axiomatic approach to fuzzy preference modelling, Fuzzy Sets and Systems 52 (1992) 47--52. J.C. Fodor and M. Roubens, Aggregation and scoring procedures in multicriteria decision making methods, Proceedings of the IEEE International Conference on Fuzzy Systems 1992, San Diego (1992) 1261--1267. J.C. Fodor and M. Roubens, Aggregation of strict preference relations in MCDM procedures, in: V. Novak, J. Ramik, M. Mares, M. Cerny and J. Nekola, Eds.: Fuzzy Approach to Reasoning and Decision Making (Academia, Prague and Kluwer, Dordrecht, 1992) 163--171. J.C. Fodor, Some remarks on fuzzy flip-flops, Technical Report TR 91/2 (Computer Center of the L. Eštvšs University, Budapest, 1991 May). J.C. Fodor, Aggregation of decomposable measures, Technical Report TR 91/3 (Computer Center of the L. Eštvšs University, Budapest, 1991 August). J.C. Fodor and T. Keresztfalvi, Non-conventional implications and conjunctions in fuzzy logic, Technical Report TR 92/2 (Computer Center of the L. Eštvšs University, Budapest, 1992 May). J. C. Fodor, A new look at fuzzy connectives, Fuzzy Sets and System (to appear). J. C. Fodor and M. Roubens, Valued preference structures, European Journal of Operational Research (to appear). J. C. Fodor, Fuzzy connectives via matrix logic, Fuzzy Sets and System (to appear). J. C. Fodor and M. Roubens, Preference modelling and aggregation procedures with valued binary relations, in: R. Lowen and M. Roubens, Eds., Fuzzy Logic: State of the Art (Kluwer, Dordrecht) (to appear). J. C. Fodor and M. Roubens, Fuzzy strict preference relations in decision making, Proceedings of the 2nd IEEE International Conference on Fuzzy Systems 1993, San Francisco (1993) (to appear). J. C. Fodor and T. Keresztfalvi, Non-standard connectives in fuzzy logic, Proceedings of the 2nd IEEE International Conference on Fuzzy Systems 1993, San Francisco (1993) (to appear). J. C. Fodor and S. Ovchinnikov, On aggregation of T-transitive fuzzy binary relations, Fuzzy Sets and Systems (to appear). Robert Fuller R.Fuller, Fuzzy mappings and their properties, Alkalmazott Matematikai Lapok, 10(1984) 353-357, (in Hungarian). [MR 87b:03126] R.Fuller, On fuzzified linear programming problems, Annales Univ. Sci. Budapest, Sectio Computatorica, 9(1988) 115-120. [MR 91h:90061], [Zbl.714-90099] R.Fuller, On stability in fuzzy linear programming problems, Fuzzy Sets and Systems, 30(1989) 339-344. [MR 90c:90143] M.Kovacs, F.P.Vasiljev and R.Fuller, On stability in fuzzified linear equality systems, Proceedings of the Moscow State University, 1989, Ser. 15, No.1 5-9 (in Russian) [Zbl.651-65028], [MR 91c:94039] M.Kovacs and R.Fuller, On fuzzified linear equality and inequality systems, In: A.A.Tihonov and A.A.Samarskij eds., Actual Problems of Applied Mathematics, Moscow State University, 1989 73-80 (in Russian). R.Fuller, Well-posed fuzzy extensions of ill-posed linear equality systems, BUSEFAL, 37(1989) 62-69. [Zbl.668-90053] R.Fuller, The law of large numbers for fuzzy numbers, BUSEFAL, 40(1989) 25-32. [Zbl.694-60024] R.Fuller, On stability in possibilistic linear equality systems with Lipschitzian fuzzy numbers, Fuzzy Sets and Systems, 34(1990) 347-353. [MR 91a:15029], [Zbl.696-15003] R.Fuller, On the solution of linear equality systems with fuzzy parameters under various kinds of t-norms, In: V.M.Repin and V.A.Morozov eds., Joint Works of Computer Centers of Moscow State University and Eotvos Lorand University, Moscow State University, 1990 32-37 (in Russian). R.Fuller, On product-sum of triangular fuzzy numbers, Fuzzy Sets and Systems, 41(1991) 83-87. [MR 92c:04008] [Zbl.725-04002] R.Fuller and T.Keresztfalvi, On generalization of Nguyen's theorem, Fuzzy Sets and Systems, 41(1991) 371-374.[MR 92g:04009] R.Fuller, On Hamacher-sum of triangular fuzzy numbers, Fuzzy Sets and Systems, 42(1991) 205-212. [MR 92d:04003] R.Fuller, Well-posed fuzzy extensions of ill-posed linear equality systems, Fuzzy Systems and Mathematics, 5(1991) 43-48. R.Fuller, On the generalized method-of-case, Annales Univ. Sci. Budapest, Sectio Computatorica, 12(1991) 107-113. R.Fuller, Some properties of possibilistic linear equality systems with weakly noninteractive fuzzy numbers,In: M.Fedrizzi, J.Kacprzyk and M.Roubens eds., Interactive Fuzzy Optimization, Springer-Verlag, Vol.368, 1991 45-48. R.Fuller, A law of large numbers for fuzzy numbers, Fuzzy Sets and Systems, 45(1992) 299-303. [MR 92j:04003] M.Fedrizzi and R.Fuller, Stability in possibilistic linear programming problems with continuous fuzzy number parameters, Fuzzy Sets and Systems, 47(1992) 187-191. R.Fuller and H.-J.Zimmermann, Computation of the compositional rule of inference, Fuzzy Sets and Systems, 51(1992) 267-275. R.Fuller and T.Keresztfalvi, t-Norm-based addition of fuzzy intervals, Fuzzy Sets and Systems, 51(1992) 155-159. R.Fuller and T.Keresztfalvi, A note on t-norm-based operations on fuzzy numbers, Supplement to Kybernetika, 28(1992) 45-49. M.Fedrizzi and R.Fuller, On stability in multiobjective possibilistic linear programs, European Journal of Operational Reseach, (to appear). EOR 1333 R.Fuller and E.Triesch, A note on law of large numbers for fuzzy variables, Fuzzy Sets and Systems, (to appear). R.Fuller, On a special type of FLP, in: D.Greenspan and P.Rozsa eds., Colloquia mathematica societatis Janos Bolyai 50. Numerical methods (Miskolc, 1986), North-Holland, Amsterdam-New York,1988 511-520. [MR 89g:90141], [Zbl.661-90058] R.Fuller, On law of large numbers for L-R fuzzy numbers, in: R.Lowen and M.Roubens eds., Proceedings of the Fourth IFSA Congress, Vol. Mathematics, Brussels, 1991 74-77. R.Fuller and H.-J.Zimmermann, On Zadeh's compositional rule of inference, in: R.Lowen and M.Roubens eds., Proceedings of the Fourth IFSA Congress, Vol. Artifical Intelligence, Brussels, 1991 41-44. R.Fuller, Multiple fuzzy reasoning approach to fuzzy mathematical programming problems, in: Proceedings of the Annual Conference of the Operational Research Society of Italy, September 18-20, 1991 Riva del Garda, Italy 126-129. R.Fuller, Stability in possibilistic linear equality systems under continuous triangular norms, in: Proceedings of the Annual Conference of the Operational Research Society of Italy, September 18-20, 1991 Riva del Garda, Italy 130-133. M.Fedrizzi and R.Fuller, On stability in group decision support systems under fuzzy production rules, in: R.Trappl ed., Proceedings of the Eleventh European Meeting on Cybernetics and Systems Research, World Scientific Publisher, London, 1992, Vol.1. 471-478. R.Fuller and B.Werners, The compositional rule of inference with several relations, in: Proceedings of the Conference on Fuzzy Sets and Systems Applications, Liptovsky Mikulas, Czecho-Slovakia, February 17-21, 1992 (to appear). R.Fuller and B.Werners, The compositional rule of inference: introduction, theoretical considerations, and exact calculation formulas, Working Paper, RWTH Aachen, Institut fur Wirtschaftswissenschaften, No.1991/7. R.Fuller and H.-J.Zimmermann, Fuzzy reasoning for solving fuzzy mathematical programming problems, Working Paper, RWTH Aachen, Institut fur Wirtschaftswissenschaften, No.1992/01. R.Fuller and H.-J.Zimmermann, On Zadeh's compositional rule of inference, In: R.Lowen and M.Roubens eds., Fuzzy Logic: State of the Art, Kluwer Academic Publisher, Norwell 1992 (to appear). P.Eklund, M.Fedrizzi and R.Fuller, Stability in multiobjective possibilistic linear programs with weakly noninteractive fuzzy number coefficients, (submitted to: M.Delgado, J.Kacprzyk, J.L.Verdegay and M.A.Vila eds., Fuzzy Optimization: Recent Advances, Omnitech Press, Warsaw and Physica-Verlag, Heidelberg, 1993. P.Eklund and R.Fuller, A neuro-fuzzy approaches to medical diagnostics, in: P.Eklund and J.Mattila ed., Proceedings of Fuzziness in Finland 1993 Workshop, Abo Akademi, Abo 1993 19-22. Lajos Gergo L.Gergo, Some Properties of Complex Fuzzy Polynomials, BUSEFAL, 35(1988) 70-79 L.Gergo, On Stability of the Root of a Fuzzy Polynomial, in: A.Ivanyi ed., Proceeding of the Fourth Conference of Program Designers, Budapest, 1988 60-65. L.Gergo, Some Properties of the Metric Spaces (E^n,D|) and (E^n,D1) of Fuzzy Numbers, in: A.Ivanyi ed., Proceeding of the Fifth Conference of Program Designers, Budapest,1989 (in Hungarian). L.Gergo, Some Remarks on the Topological Properties of Fuzzy Numbers in R^n, BUSEFAL, No. 41(1990) 53-61. L.Gergo, Generalisation of the Goetschel-Voxman Embedding, Fuzzy Sets and Systems, 47(1992) 105-108. L.Gergo, Some Remarks on the Topological Properties of Fuzzy Numbers in R^n, Fuzzy Sets and Systems, 48(1992) 275-277. Tibor Keresztfalvi T. Keresztfalvi and H Rommelfanger, Fuzzy linear programming with t-norm-based extended addition, Operations Research Proceedings 1991, Springer Verlag, Berlin Heidelberg (1992) 492-499. T. Keresztfalvi, Operations on fuzzy numbers extended by Yager's family of t-norms, Proc. of GAMM Workshop, Freiberg, Germany, 1992 R. Fuller and T. Keresztfalvi, On generalization of Nguyen's theorem, Fuzzy Sets and Systems, No. 41, 371-374 (1991) (short version: Some extensions of Nguyen's theorem, BUSEFAL, No. 41, 49-52 (1990)) T. Keresztfalvi and M. Kovacs, g,p-fuzzification of arithmetic operations, Proc. of Int. Conf. on Fuzzy Sets Theory and Applications, Liptovsky Mikulas, 1992 R. Fuller, T. Keresztfalvi, t-norm-based addition of fuzzy intervals, Fuzzy Sets and Systems, No. 51, 155-159 (1992) (short version: t-norm-based addition of fuzzy intervals, BUSEFAL, No. 46, (1991)). J. C. Fodor, T. Keresztfalvi: Non-standard connectives in fuzzy logic, Proc. of 2nd IEEE Int. Conf. on Fuzzy Systems, San Francisco, March 28 - April 1, 1993 (to appear) R. Fuller and T. Keresztfalvi, A note on t-norm-based operations on fuzzy numbers, Kybernetika, No. 5, 45-49 (1991). T. Keresztfalvi, t-norm based operations on fuzzy sets, Annales Univ. Sci. Bud., Sect. Comp., XII., 127-132 (1991), Proc. of 3rd Joint IFSA-EC and EURO-WG Workshop on Fuzzy Sets, Visegrad, 1990. T. Keresztfalvi: t-norm-based product of fuzzy numbers, BUSEFAL, No. 49, 14-19 (1991-92). Attila Kiss A.Kiss, On Dependencies in Fuzzy Relational Databases 5th Conference of Program Designers 1989. pp. (to appear). A.Benczur, A.Kiss, T.Markus, On the Generalized Dependencies of Relational Databases and their Implication Problems Vestnik of MGU (Moscow), No. 1. 1989. pp. 34-44. A.Kiss, The truth values of dependencies of fuzzy databases Proceedings of First Finnish-Hungarian Workshop on Computer Science, Szeged, Aug 8-11, 1989. pp. 177-186. A.Kiss, On fuzzy relational databases Proceeding of Mathematical Sciences Past and Present, Hamburg, March 18-25, 1990. pp. 1183-1193. A.Kiss, Application of fuzzy graphs in database theory I. Peak Memorial Conference, Salgotarjan, May 21-24, PU.M.A. Ser. A, Vol. 1., No. 3-4, 1990. pp. 337-342. A.Kiss, Transaction Schemes and Dependency Types Seminar on Computer Scienses, Visegrad, September 3-4, 1990. pp. (to appear). A. Kiss, Decomposition of Fuzzy Databases, Third Joint IFSA-EC and EURO-WG Workshop on Fuzzy Sets, Visegrad, December 11-13, 1990., Annales Univ. Sci. Budapest, Sect. Comp 12. 1991. pp. 133-142. A. Kiss, On Uncertain Information Management Systems Second Conference on Artificial Intelligence, Budapest, January 23-25, 1991. pp. 257-262. A. Benczur, A. Kiss, T. Markus, On a General Class of Data Dependencies in the Relational Model and its Implication Problems Computers Math. Applic. Vol. 21., No. 1, 1991. pp. 1-11. A. Kiss, The Application of The Separation Principle for the Linear Continous Systems with Coloured Noise Computers Math. Applic. Vol. 21., No. 1, 1991. pp. 119-128. A. Kiss, On the least models of fuzzy Datalog programs Proceedings of IMPU' 92, Palma de Mallorca, 1992. pp. 465-471. A. Kiss, On the least models of fuzzy Datalog programs Intelligent Systems with uncertainty, ed. B. Boucheon-Meunier, L. Valverde, R. Yager, Elsevier, 1993 (to appear). Laszlo T. Koczy* *not complete list, for more items please contact h1256koc@ella.hu L.T.Koczy, Reasoning and control with incomplete and contradicting fuzzy rule basis, ISKIT'92 Iizuka. L.T.Koczy and K.Hirota, Reasoning by analogy with fuzzy rules, in: Proc. of IEEE Int. Conf. on Fuzzy Systems, San Diego, California, 1992 263-270. L.T.Koczy and K.Hirota, Interpolation in structured fuzzy rule bases, in: Proc. of Second IEEE International Conference on Fuzzy Systems, 1993 402-405. J.H.Han, L.T.Koczy and T.Poston, Fuzzy Hough Transform, in: Proc. of Second IEEE International Conference on Fuzzy Systems, 1993 803-808. L.T.Koczy and K.Hirota, Rule interpolation by alpha-level sets in fuzzy approximate reasoning, BUSEFAL, 46(1991) 115-123. L.T.Koczy K.Hirota and A.Juhasz, Fuzzy rule interpolation and the RULEINT program, Joint HUngarian - Japanase Symp. on Fuzzy Systems and Applications, Budapest, 1991 91-94. L.T.Koczy K.Hirota and A.Juhasz, Interpolation of 2 and 2k rules in fuzzy reasoning, Int. Fuzzy Eng. Symp.'92, Yokohama, 206-217. L.T.Koczy and K.Hirota, Analogical fuzzy reasoning and gradual inference rules, in: Proceedings of the 2nd International Conference on Fuzzy Logic and Neural Networks, Iizuka, Jono Printing Co. Ltd, 1992 329-332. L.T.Koczy, On the computational complexity of rule based fuzzy inference, Proc. of NAFIPS-91 Columbia, Missouri, 1991, 87-91 L.T.Koczy, K.Hirota and A.Juhasz, Approximate reasoning by linear rule interpolation, Int. J. of Approxiamate Reasoning, (to appear). L.T. Koczy, Complexity of bounded compact rule based fuzzy inference, Proc. Third Joint IFSA-EC and EURO-WG Workshop on Fuzzy Sets, Visegrad, 1990, 59-60. L.T. Koczy, Interactive formulation of fuzzy algebra and its application as a model of function capability, in: S. Bocklisch, S. Orlowski, M. Peschel and Y. Nishiwaki, Eds., Fuzzy Sets Applications, Methodological Approaches, and Results (Akademie-Verlag, Berlin, 1982) 9-20. L.T. Koczy, Vectorial I-fuzzy sets, in: M.M Gupta and E. Sanchez, Eds., Approximate Reasoning in Decision Analysis (North-Holland, Amsterdam-New York, 1982) 151-156. L.T. Koczy and C. Magyar, On the minimal axiomatic system of I-fuzzy structure, BUSEFAL 32 (1987) 19-31. L.T. Koczy, Problems of availability of stored program controlled switching system with hierarchical tree structure, Chapter 2, "Candidate of Engineering Science" Thesis, Technical University of Budapest (1987) 14-70 (in Hungarian). L.T. Koczy and P.T. Binh, Further results in availability optimization with uncertain graphs, Manuscript, Technical University of Budapest (1988). L.T. Koczy, Maximal availability of tree structured fault tolerant system, in: F.Belli and W.Gšrke, Eds., Fault-tolerant Computing Systems (Springer-Verlag, Berlin-New York, 1987) 314-323. L.T.Koczy, Fuzzy graphs in the evaluation and optimization of networks, Fuzzy Sets and Systems, 46(1992) 307-319. L.T.Koczy and P.T.Binh, Large fuzzy trees, in: I.B.Turksen ed., Proc. of NAFIPS'90, University of Toronto, june 6-8, 1990 243-245. L.T.Koczy, Computational complexity of various fuzzy inference algorithms, Annales Univ. Sci. Budapest, 1(1991) 151-158. L.T.Koczy and H.Hirota, Interpolative reasoning with insufficient evidence in sparse fuzzy rule bases, Information Sciences (to appear). L.T.Koczy, Techniques of inference in insufficient and inconsistent fuzzy rule bases, Proc. of Non-Classical Logics and their Applications, Linz, 1992 46-50. Margit Kovacs F.Herrera, M.Kovacs, and J.L. Verdegay, Fuzzy linear programming problems with homogeneous linear fuzzy functions, In: Proc. of IPMU'92, 361--364. Universitat de les Illes Balears, 1992. F.Herrera, M.Kovacs, and J.L. Verdegay, Homogeneous linear fuzzy functions and ranking methods in fuzzy linear programming problems. J. Uncertainty, Fuzziness and Knowledge-based Systems, 1(2), 1993. (to appear) M.Kovacs, F.P.Vasiljev and R.Fuller, On stability in fuzzified linear equality systems, Proceedings of the Moscow State University, 1989, Ser. 15, No.1 5-9 (in Russian) [Zbl.651-65028], [MR 91c:94039] M.Kovacs and R.Fuller, On fuzzified linear equality and inequality systems, In: A.A.Tihonov and A.A.Samarskij eds., Actual Problems of Applied Mathematics, Moscow State University, 1989 73-80 (in Russian). F.Herrera, M.Kovacs, and J.L. Verdegay, An optimum concept for fuzzified linear programming problems: a parametric approach. In Fuzzy Sets. Proc. of the Int. Conf. on Fuzzy Sets and its Applications, pages 57--64. Math. Inst. Slovak Academy of Sciences, Bratislava, 1992. F.Herrera, M.Kovacs, and J.L. Verdegay, Optimality for fuzzified mathematical programming problems: a parametric approach, Fuzzy Sets and Systems, 54(1993) 279-285. S.Jozsef and M.Kovacs, Fuzzy regression on fuzzy observations, In L.T. Koczy and K.Hirota, editors, Joint Hungarian-Japanese Symposium on Fuzzy Systems and Applications, pages 76--78. Japan Society for Fuzzy Theory and Systems (SOFT) and Technical University of Budapest, 1991. T.Keresztfalvi and M.Kovacs, g,p-fuzzification of arithmetic operations. In Fuzzy Sets. Proc. of the Int. Conf. on Fuzzy Sets and its Applications, pages 65--71. Math. Inst. Slovak Academy of Sciences, Bratislava, 1992. M.Kovacs, Fuzzification of ill-posed linear systems, In D.Greenspan and P.Rozsa, editors, Numerical Methods, number50 in Colloquia Math. Soc. J.Bolyai, pages 501--512. North Holland,1987. M.Kovacs, Fuzzy linear programming with triangular fuzzy parameters. In M.H. Hamza, editor, Proc. of Intern. Symp. on Identification, Modelling and Simulation, Publications of IASTED, 447--451, IASTED, 1987. M.Kovacs, Fuzzy LP problems with exponential fuzzy numbers. In: Proc. of Intern. Tagung Math. Optiemirung-Theorie und Anwendungen, pages 93--96, 1987. M.Kovacs.On the g-fuzzy linear systems, BUSEFAL, 37:69--77, 1988. M.Kovacs, Fuzzy linear model fitting to fuzzy observations. In M.Fedrizzi and J.Kacprzyk, editors, Fuzzy regression analysis, Studies in Fuzziness, pages 116--123. Omnitech Press, 1991. M.Kovacs, Fuzzy linear programming problems with min- and max-extended algebraic operations on centered fuzzy numbers, In: R.Lowen and M.Roubens, editors, Computer, Management & Systems Science, IFSA'91 Brussels, 125--128. IFSA, IFSA, 1991. M.Kovacs, Linear programming with centered fuzzy numbers, Annales Univ. Sci. Budapest, Sectio Comp., 12:159--165, 1991. M.Kovacs, On a special class of fuzzy linear programming, In: L.T. Koczy and K.Hirota, editors, Joint Hungarian-Japanese Symposium on Fuzzy Systems and Applications, 95--97. Japan Society for Fuzzy Theory and Systems (SOFT) and Technica University of Budapest, 1991. M.Kovacs, An optimum concept for fuzzified mathematical programming problems, In M.Fedrizzi, J.Kacprzyk, and M.Roubens, editors, Interactive Fuzzy Optimization, pages 36--44. Springer Verlag, 1991. M.Kovacs, A concept of optimality for fuzzified linear programming based on penalty function, In V.Novak atall, editor, Fuzzy Approach to Reasoning and Decision Making, pages 133--139. Academia,Prague and Kluwer,Dordecht, 1992. M.Kovacs, Fuzzy linear programming problems with min- and max-extended algebraic operations on centered fuzzy numbers, In: R.Lowen and M.Roubens, editors, State of Arts. Kluwer, 1992. (to appear) M.Kovacs, An optimum concept for fuzzified linear programming problems. In W.Buhler etal., editor, Operations Research Proceedings 1990, DGOR, Springer-Verlag, 1992. M.Kovacs, A stable embedding of ill-posed linear systems into fuzzy systems. Fuzzy Sets and Systems, 45(3):305--312, 1992. M.Kovacs, Fuzzy linear programming with centered fuzzy numbers, In: M.Delgado et al., editor, Fuzzy Optimization, Omnitech Press 1993. (to appear) M.Kovacs and L.H. Tran, Algebraic structure of centered M-fuzzy numbers. Fuzzy Sets and Systems, 39(1):91--99, 1991. M.Kovacs and P.Varlaki, On \mu-fuzzy economic equilibrium and its stability, In: L.F.Pau B.Martos and M.Ziermann, editors, Dynamic Modelling and Control of National Economies, number5 in IFAC Proceeding Series, 91--96. IFAC, Pergamon Press, 1986. M.Kovacs and I.Zsigmond, On the fuzzy quadratic assignment problem. In: L.T. Koczy and K.Hirota, editors, Joint Hungarian-Japanese Symposium on Fuzzy Systems and Applications, 98--101. Japan Society for Fuzzy Theory and Systems (SOFT) and Technical University of Budapest, 1991. From NAFIPS-L@GSUVM1.BITNET Thu Apr 15 17:35:15 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 6622; Thu, 15 Apr 1993 17:34:47 +0100 Date: Thu, 15 Apr 1993 11:57:20 +0200 From: Thomas Runkler Subject: defuzzification paper Dear defuzzification interests, because of the large number of requests I decided to put my paper "A set of defuzzification strategies - Towards a theory of rational defuzzification operators" to our FTP server. It is now available via anonymous ftp at obelix.microelectronic.e-technik.th-darmstadt.de (130.83.30.14) in the directory /pub The filename is thomasr0493.ps.Z The paper was published in the Proceedings of the Second IEEE International Conference on Fuzzy Systems, San Francisco, March/April 1993, pages 1161--1166. For short, this is the abstract: Fuzzy systems internally process fuzzy values, which have to be mapped to crisp output in most applications (defuzzification). In many cases the standard algorithms like center of gravity and mean of maxima lead to irrational results - we need better defuzzification procedures. For the development of "rational" defuzzification algorithms we need a definition of essential properties (designer intentions). We develop a mathematically motivated set of 13 constraints characterizing rational defuzzification procedures. These properties can be used for direct operator derivation, for comparative examinations or as quality criteria: a step towards rational defuzzification. Best regards - Thomas A Runkler ------------------------------------------------------------------------------ Thomas A Runkler Darmstadt University of Technology Institute of Microelectronic Systems Karlstrasse 15 Tel. (+49)6151 16 4337 D-6100 Darmstadt Fax (+49)6151 16 4936 GERMANY Email thomasr@microelectronic.e-technik.th-darmstadt.de ------------------------------------------------------------------------------ From NAFIPS-L@GSUVM1.BITNET Thu Apr 15 19:20:17 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 1754; Thu, 15 Apr 1993 19:20:06 +0100 Date: Thu, 15 Apr 1993 14:17:38 SLT From: "Dr. Hamdi T. Hemdan" Subject: Inquiry about Group Activities DEAR SIRS, I WOULD LIKE TO INQUIRE ABOUT THE KIND OF ACTIVITIES YOU ARE INT ERESTED IN. WE AT THE DEPARTMENT OF MATHEMATICS, KING SAUD UNIVERS ITY ARE INTERESTED IN ALL MATHEMATICS RELATED SUBJECTS, COMPUTER SOFTWARE OR HADWARE INFORMATION, UNIVERSITY RESEARCH, EMPLOYMENT, SEMINARS, AS WELL AS SUBJECTS RELATED TO MATHEMATICS. HOPING TO HEAR FROM YOU SHORTLY. SINCERELY YOURS, DR. HAMDI T. HEMDAN KING SAUD UNIVERSITY MATHEMATICS DEPARTMENT RIYADH 11451, SAUDI ARABIA From mpatyra@uc.d.umn.edu Thu Apr 15 22:51:57 1993 Date: Thu, 15 Apr 93 15:53:02 CDT From: mpatyra@uc.d.umn.edu (marek patyra) ******************************************************************************* ******************************************************************************* Extended Announcement! ******************************************************************************* "Fuzzy Logic VLSI Implementations and Applications" 9 - 11 June 1993 Swiss Federal Institute of Technology EPFL-Lausanne Switzerland Objective --------- This three-day seminar is the first part of 13-day course. The idea of this course is to provide participants with the necessary bekground covering fuzzy sets theory and fuzzy logic along with demonstrations of practical solutions. CMOS VLSI design and implementation as well as fuzzy system simulation will be presented in details. Course Outline and Presenters ############################################################################### Introduction Prof. Henri Prade, Institute de Recherche en Informatique de Toulouse, France BIOGRAPHICAL NOTE Henri Prade is a Directeur de Recherche at the French National Center for Scientific Research (CNRS) and works at the Institut de Recherche en Informatique de Toulouse (IRIT) located at the Universite Paul Sabatier in Toulouse. He has contributed extensively to fuzzy sets and possibility theory and their applications for more than 15 years. He is the author (with Didier Dubois) of two books and many papers on this topic, and in the related field of uncertainty management in AI systems. He has recently edited Readings in Fuzzy Sets for Intelligent Systems (with D. Dubois and R. Yager) gathering significant papers on fuzzy set methods and applications published between 1965 and 1991. PRESENTATION DESCRIPTION The course will focus more particularly on the basic principles underlying fuzzy sets and possibility theory, with a view to applications to control systems, decision support systems, advanced information systems and knowledge-based systems. Basic ideas will be emphasized and some illustrative examples provided. ############################################################################### Design of fuzzy digital circuits Prof. Laszlo Koczy, Department of Industrial Engineering, Technical University of Budapest, Hungary BIOGRAPHICAL NOTE Position: associate professor Degrees: M.Sc. in Electrical Engineering (Fuzzy Theory and Fuzzy Control), Ph.D. 1977 Fuzzy Theory and Applications, both from the Technical University of Budapest, C.Sc.Eng. 1989, Random and Fuzzy Graphs, Hung. Acad. of Science. Visiting Appointements: Dalian Maritime University, China, 1990 (teaching Fuzzy Theory and Applications) Dept. of Computer Science, Pohang Inst. of Science and Technology, Korea 1992 (teaching fuzzy) Research Interests: Fuzzy operations with a special stress on algebraic operations. Fuzzy graphs and the use in network analysis and optimization. Fuzzy digital circuits, flip-flops and learning networks. Fuzzy control, interpolation and extrapolation of rule bases, reduction of computational complexity. PRESENTATION DESCRIPTION The design of fuzzy digital circuits - Fuzzy operations with a stress on strictly monotonous connectives - Storing fuzzy information in fuzzy bits (fits). The importance in multistep fuzzy control. - The concept of fuzzy flip-flop (F3) - Min-max flip-flop. Algebraic F3 - Circuits constructed with F3 - The problems of realizing F3 - The analog anfd digital (continuous and discrete mode) approach. - Experience with the various type F3 built by Hosei University/ Techn. Universitu of Budapest. - Conclusions ############################################################################### CMOS VLSI Implementation Prof. Marek Patyra, Department of Computer Engineering, University of Minnesota, USA BIOGRAPHICAL NOTE J. Patyra is an Assistant Professor at the Department of Computer Engineering, University of Minnesota, Duluth, MN, USA. He received the M.S. and Ph.D. degrees from Warsaw University of Technology, Warsaw, Poland in 1978, and 1986 respectively. From 1978 to 1989 he worked as an Assistant Professor at the Institute of Electron Technology, Warsaw, Poland. >From 1989 to 1991 he was a Research Associate at the Department of Electrical and Computer Engineering, Carnegie Mellon University, Pittsburgh, PA where he worked techniques for circuit design for manufacturability. During the Summer 1992 he was a Visiting Professor at the Swiss Federal Institute of Technology, Lausanne, Switzerland. He published several papers on VLSI implementation of fuzzy logic circuits. His main research area concentrates on analog and digital VLSI implementation of fuzzy and neural systems. PRESENTATION DESCRIPTION 1) Digital Implementation of Fuzzy Logic Circuits -Background -Digital Implementation of MAX and MIN Operators -Digital Fuzzification -Digital Defuzzification -Fuzzy Model Building -Fuzzy Logic Based VLSI Processors -Fuzzy Logic Based VLSI Controllers 2) Analog Implementation of Fuzzy Logic Circuits A) Current Mode Circuits Principles. -Basic Concept of Current Mode Circuits -Current Mode Static Circuits - Basic Concept -Circuit Overview (Bounded Difference - Complement) -Current Mode Dynamic Circuits (Bounded Difference, MIN, MAX) -Fuzzy Logic VLSI Circuits in Current Mode B) Voltage Mode Circuits. -Operation of Voltage Mode Circuits. -Circuit Overview (Bounded Difference - Complement) -Fuzzy Logic VLSI Circuits in Voltage Mode ############################################################################### Fuzzy Systems Simulation Ing. Laurent Lemaitre, Department of Electrical Engineering, Swiss Federal Institute of Technology, Lausanne, Switzerland BIOGRAPHICAL NOTE L. Lemaitre obtained his MS degree in Electrical Engineering from the the Institut National Polytechnique de Grenoble, France. He is currently working toward his PhD degree in Electrical Engineering the Swiss Federal Institute of Technology His reaserch interests include design of CMOS fuzzy systems and multivalued logic theory. He is also interested in possibility and uncertainty theories. PRESENTATION DESCRIPTION 1) Fuzzy Logic Based Controllers - Analogic approach - Digital approach 2) FLC#1: a Case Study developed at the Swiss Federal Institute - Fuzzification - Inference engine - Defuzzification 3) Practical Applications studied at the C3i Lab - Autofocus - Pattern Recognition - Control of a Car In common with Prof Marek Patyra 1) SCOFIC: Silicun Compiler of Fuzzy Integrated Circuits - Mathematical models of fuzzy units - Automatic generation - HSPICE simulations and Logic simulations: comparisons 2) GDT tools and Layout Generators - Min and Max units - Center of Gravity ############################################################################## CMOS VLSI Fuzzy Circuits Design Ing. Olivier Landolt, Centre Suisse d'Electronique et de Microtechnique, SA Neuchatel, Switzerland BIOGRAPHICAL NOTE Oliver Landolt reveived his MS degree in Electrical Engineering from EPFL in January 1992; His diplome project was carried out at the Electronics Laboratory, and oriented towards the analog CMOS IC design. He has been working as a R&D Engineer at the Swiss Center for Electronics and Microtechnology, Inc. (CSEM SA) since March 1992. His main research topics include analog implementation of fuzzy logic circuits and Kohonen networks. Other activities include developing advanced applications using those two techniques. PRESENTATION DESCRIPTION 1) implementing massively parallel structures in analog VLSI: - crucial requirements (density, power consumption) - identification of the essential properties needed for the cells - opportunistic choice of easily implementable functions 2) qualitative study of a set of fuzzy rules: - basic properties expected from the "condition" part - properties of the conclusion part - combining several rules 3) easily implementable equivalent functions for the two parts of a rule: - distance computing circuits - center of gravity circuits 4) analog CMOS family of cells: - condition and conclusion cells - storage cells - modular building of fuzzy rules 5) rulebase configurations for practical applications: - application specific: arbitrary configuration - general purpose: matrix of rules 6) using the programmable rule matrix as a new component: - stand-alone possibilities - parallel or hierarchical structures - implementing stationary or dynamical systems ############################################################################### !!! A SPECIAL GUEST PRESENTATION IS ALSO PLANNED !!! ############################################################################### Who should attend ? ------------------- Electronic engineers, company decision makers, VLSI and ASIC designers, technicians, and university & high school students. Participants are free to attend part I (first three days Seminar), or part II (three weeks Workshop), or to combine part I and part II. Fees ---- Part I (three days) SFr. 800.- (Fee covers Notebooks, slide copies, program materials, break refreshments and lunches.) !!! Attention: Special discount for students 50%. !!! Organizers will help in finding the reasonable asccomodation in Lausanne. For more information contact: USA: Marek Patyra at (218) 726-6103 or through e-mail: mpatyra@uc.d.umn.edu EUROPE: Laurent Lemaitre at (41)-(21)-693-6978 or through e-mail: Laurent_Lemaitre@deqm.epfl.ch ******************************************************************************* ******************************************************************************* Workshop Announcement! UPDATED ******************************************************************************* "Practical Problem Solving Using Fuzzy Technology" June 9 - 25, 1993 and September 20 - 24, 1993 Swiss Federal Institute of Technology EPFL-Lausanne Switzerland Objective --------- This four weeks course/workshop is an international course in cooperation with the Department of Computer Engineering, University of Minesota, USA. The idea of this course is to provide participants the necessary bakground covering the fuzzy sets theory and fuzzy logic (first week) along with demonstrations of practical solutions (second and third week). CMOS VLSI design and implementation as well as fuzzy system simulation will be presented. The second and third week are dedicated to the design of a Fuzzy logic based chip, which will be fabricated and tested in the fourth week (20 to 24 September 1993). Attendants will de disigning their own chips according to the problems they intend to solve. Outline ------- Week I: Introduction to Fuzzy Logic Theory Week II: Project formulation and solving Week III: Project simulation and fuzzy ASIC chip design Week IV: Chip testing (after manufacturing) Who should attend ? ------------------- Electronic and computer engineers, company decision makers, VLSI and ASIC designers, university & high school students. Participants are free to attend the part I (first three days), or part II (three weeks), or to combine part I and part II of the Seminar/Workshop. Fees ---- Three days (part I) SFr. 800.- Four weeks (part II) SFr. 4,500.-* Fees cover Notebooks, slide copies, program materials, break refreshments and lunches. In case of the Workshop organizers will help with accomodation in Lausanne. For more information contact Marek Patyra at (218) 726-6103 or through e-mail: mpatyra@uc.d.umn.edu. _________________________________________________ *This price includes the chip manufacturing cost. ******************************************************************************* From RFULLER@finabo.abo.fi Sat Apr 17 09:19:00 1993 <01GX45JBBD9OCG93EO@finabo.abo.fi>; Sat, 17 Apr 1993 10:50:34 EET Date: 17 Apr 1993 10:50:34 +0200 (EET) From: RFULLER@finabo.abo.fi Subject: Recent Statistics about Who is Who in Fuzzy Mime-Version: 1.0 Dear Colleagues, For the time being, we have 83 contributions in "Who is Who in Fuzzy" file from the following 21 countries Austria 8 Australia 2 Canada 1 Belgium 7 Denmark 2 France 5 Finland 9 Czech Republik 2 Hungary 6 Germany 12 Hong Kong 1 Israel 1 Italy 2 Japan 1 Norway 1 Switzerland 1 United Kingdom 4 Romania 1 Turkey 1 Spain 6 USA 10 Please remember that new entries into "Who is Who in Fuzzy" and recent changes in your address should be sent directly to me rfuller@finabo.abo.fi (IN NO CASE TO THE LIST, please), and preferable in the following format ---------------------------------------------------------------------- Robert Fuller Department of Computer Science, Eotvos Lorand University, P.O.Box 157, H-1502 Hungary, phone: 36-1-1869-066, fax: 36-1-811-976, e-mails: rfuller@finabo.abo.fi, rfuller@granada.elte.hu is interested in - Using fuzzy reasoning techniques for solving fuzzy mathematical programming problems, - Linear and nonlinear systems with fuzzy numbers, t-norm-based-operations on fuzzy sets, - Fuzzy control, - Neuro-fuzzy techniques for medical diagnostics. Remark: Recent address: Institute for Advanced Management Systems Research, Abo Akademi University, Lemminkainengatan 14, SF-20520 Abo, Finland, phone: 358-21-654754, fax: 358-21-654732, e-mail: rfuller@finabo.abo.fi. ---------------------------------------------------------------------- The actual "Who is Who in Fuzzy" can be obtained by sending a message to listserver@vexpert.dbai.tuwien.ac.at with a body consisting of nothing but the command GET LISTSERVER WHOISWHOINFUZZY I am waiting for your records. Thank you in advance. With my best wishes. Robert. From Mueller@EWIKO.DBP.de Sun Apr 18 08:02:03 1993 Relayed; Sun, 18 Apr 1993 08:01:55 +0200 Sun, 18 Apr 1993 09:02:07 +0200 Sun, 18 Apr 1993 09:01:45 +0200 Sat, 17 Apr 1993 07:43:20 +0200 Fri, 16 Apr 1993 20:26:06 +0200 Date: Fri, 16 Apr 1993 20:26:06 +0200 From: Mueller@EWIKO.DBP.de Subject: new fuzzy-newsletter in germany Dear Colleagues, a new fuzzy-newsletter will appear very soon in Germany. Editors of the "Fuzzy-Monitor" are Friedrich Braeuninger and Manfred Hasenbeck, former chief-editors of the "highTech"-Magazin. Co-Editors are Prof. Zadeh and Prof. Zimmermann. The monthly "Fuzzy-Monitor" will report on trends and developments in research, applications and markets. There also will be a service-section with announcements and conference-reports. If you want a free copy of the number-zero-issue of "Fuzzy-Monitor" contact: EditorNetwork Josephspitalstrasse 15/III D-8000 Muenchen 2 Germany Phone: (++49) 89/593388 Fax (++49) 89/5501811 If you are interested to publish new and exclusive information in the field of fuzzy logic please contact Mr. Braeuninger at the same address or send an E-Mail to me: mueller@ewiko.dbp.de. Deadline is the 25th of april. best regards - Wolfgang Mueller From wsi@altair Sun Apr 18 16:46:33 1993 Date: Sun, 18 Apr 93 16:44:09 +0200 From: wsi@altair (Wolfgang Slany) Subject: cfp&p: Fuzzy Scheduling WS at FLAI'93 (Call for Papers & Participation) FLAI'93 Workshop "Fuzzy Scheduling Systems" 28th June 1993, Bildungshaus St. Magdalena, Linz, Austria Call for Papers & Participation Scheduling is an activity which is often based on uncertain time estimates and loosely specified preferences and constraints which can often be relaxed. An increasing number of researchers have recently started to explore the potential uses of fuzzy set theory, fuzzy logic and fuzzy arithmetic to assist in the more realistic representation of the uncertainty and vagueness often inherent in schedules. This workshop is intended to provide a forum for those having an interest in this field to meet for the presentation and discussion of recent research, to raise possible research or philosophical issues, and to report on applications. The format of the workshop will consist of a series of individual presentations with a total of thirty minutes (including discussion) being allowed for each. The language of the Workshop will be English. Themes . fuzzy scheduling heuristics . fuzzy preference constraint representation and relaxation . temporal constraint representation and propagation using fuzzy arithmetic . fuzzy knowledge elicitation: mapping linguistic scheduling variables and preferences on to fuzzy sets . methods of comparative evaluation of crisp and fuzzy schedules . philosophical implications . case studies Participation Intending participants are invited to to submit (in English) two copies of an extended abstract on one of the above themes to Roger Kerr at the address below. The length of the abstract, including diagrams, tables and references, should not exceed 5 double-spaced A4 pages at 10cpi pitch. A complete set of copies will be distributed to participants at the workshop. Roger Kerr Christian Doppler Institute for Expert Systems Technical University of Vienna Paniglgasse 16 A-1040 Vienna Austria Tel ++43-1-58801-6112, Fax ++43-1-5055304 ------------------------------------------------------------------------- Eighth Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Call for Participation and Registration Form General Information Flai'93 will be a forum for presentation of new results in research, development and applications of Fuzzy Logic in Artificial Intelligence. The conference will favor the sharing of information between researchers and practitioners, and outline future developments of Fuzzy Logic applications in Artificial Intelligence. The conference will take place in a cozy, seminar-like atmosphere on a hill overlooking Linz. The conference language will be English for the Scientific Program and the Workshops, the Tutorials will be given in German. Program Workshops June 28, 1993 * Workshop for Doctoral Students in Fuzzy-Based Systems * Fuzzy Logic for Commercial and Industrial Applications (English/German) / Fuzzy Logic fuer Wirtschaft und Industrie (Deutsch/Englisch) * Karl Menger, Fuzzy Logic and Artificial Intelligence - An Experiment in Reflection * Fuzzy Scheduling Systems Detailed information on the workshops follows. Persons wishing to attend a workshop must register to the technical program of FLAI'93 and contact the workshop organizers. Paper contributions are welcome, please send them directly to one of the corresponding workshop organizers. Tutorials June 28, 1993 (auf Deutsch / in German) * Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH Aachen * Nachmittag: Fuzzy Control - Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig Genaue Informationen zu den Tutorials folgen. Scientific Program June 29-30, 1993 Invited Talks: * The Role of Fuzzy Logic and Soft Computing in the Conception and Design of Intelligent Systems, Lotfi A. Zadeh, University of California, Berkeley * Contextual Approach for AI Systems Development, Irina Ezhkova, Russian Academy of Sciences, Moscow Regular Paper Sessions: * Neural Networks, Genetic Algorithms, other learning paradigms, and Fuzzy Logic * Expert Systems and Fuzzy Logic * Robotics, Control, and Fuzzy Logic * Medicine and Fuzzy Logic * Driving with Fuzzy Logic * Theoretical Issues Panels and Special Sessions: * Panel 1: FL&AI: differences and meeting points. * Panel 2: A critical view on what is going on in Fuzzy Logic and Artificial Intelligence: Hit, Hype or both? * Workshop overview session. * ESPRIT Session: The session will present the EC view on the structure and content of Fuzzy Logic or Artificial Intelligence-related projects recently accepted in the ESPRIT program. Persons interested in participating in panels or other special sessions should contact the conference chairpersons. Details on the scientific program will be sent out to you before the conference. Exhibitions June 28-30, 1993 * There will be an exhibition on recent books relevant to the conference's theme "Fuzzy Logic in Artificial Intelligence". Suggestions for books to be exhibited are welcome. * Another exhibition will display Fuzzy Logic and Artificial Intelligence related hard- and software. Companies or individuals wishing to participate should contact the organizers. Conference Organizer Oesterreichische Gesellschaft fuer Artificial Intelligence / Austrian Society for Artificial Intelligence Conference Chairpersons Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 Wolfgang Slany Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6123 Fax: +43-1-5055304 Program Committee K.-P. Adlassnig (Austria) D. Dubois (France) M. Fedrizzi (Italy) A. Geyer-Schulz (Austria/Germany) V. H. Haase (Austria) R. Kruse (Germany) R. Lopez de Mantaras (Spain) M. Reinfrank (Germany) Ph. Smets (Belgium) H. Takagi (Japan/USA) R. R. Yager (USA) M. Zemankova (USA) H.-J. Zimmermann (Germany) Workshop Organizers Rainer Born (Johannes Kepler Universitaet Linz) Johann Gamper (Universitaet Wien), Andreas Geyer-Schulz (Wirtschaftsuniversitaet Wien / Universitaet Augsburg) Roger Kerr (Technische Universitaet Wien / University of New South Wales) Peter Kotauczek (BEKO GesmbH., Wien) Bernhard Moser (Universitat Salzburg) Cooperating Institutions Fuzzy Logic Laboratorium Linz Christian Doppler Labor fuer Expertensysteme Supporting Companies and Institutions BEKO - Ing. P. Kotauczek GesmbH., Wien Technologie und Marketing GesmbH., Linz European Coordinating Committee for Artificial Intelligence ************************************************* * For a free INVITATION PROGRAM please contact: * ************************************************* by E-mail: flai93_info@vexpert.dbai.tuwien.ac.at (automatic reply with latest information), or Ms. Heidi Milos - FLAI'93 Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6125 Fax: +43-1-5055304 E-mail: flai93_secr@vexpert.dbai.tuwien.ac.at -------------------Cut-Here-For-Registration-Form------------------- REGISTRATION FORM - FLAI'93 - ANMELDUNGSFORMULAR Eighth Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Full name [] Ms. [] Mr. [] Dr. [] Prof.: Name as you would like it on your badge: Address: Telephone: Fax: E-Mail: Tutorials June 28, 1993 (auf Deutsch / in German, mit Mittagessen) [] Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH/ELITE Aachen ATS 2,000.- [] Nachmittag: Fuzzy Control-Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig ATS 2,200.- [] Ermaessigte Gebuehr fuer Teilnehmer an beiden Tutorials ATS 3,700.- Technical Program June 28-30, 1993 (including workshops, proceedings, receptions and lunches) until May 14, 1993: [] ATS 1,900.- [] Full-time student* ATS 800.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. after May 14, 1993: [] ATS 2,300.- [] Full-time student* ATS 1,000.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. [] for participants of tutorials / fuer Tutorialteilnehmer ATS 1,500.- [] OEGAI members: substract ATS 150.- (applies only once) Bed and breakfast at the conference site / Unterkunft und Fruehstueck am Tagungsort Accommodation at the conference site is ATS 500.- per night and person. Very few double rooms are available directly at the conference site. [] Please reserve [ ] single rooms [ ] double rooms Arrival date: Departure date: [] ATS 500.- x [ ] nights x [ ] persons = =====> TOTAL in Austrian Schillings (ATS) = _______________________________________________________________________ Method of Payment / Zahlungsmodus [] Transfer to bank account / Ueberweisung auf Konto [] Postal Giro account "OEGAI", no. 92,016-129, Vienna. [] Die Erste Oesterreichische Spar-Casse-Bank Wien "OEGAI", Konto-Nr. 004-71186, BLZ 20111 [] Eurocheque / Euroscheck (Please make cheque payable to "OEGAI") All cheques should be in Austrian Schillings (ATS 100.- corresponds to approximately US$ 8.55). Payment must accompany registration. In order to keep registration costs down, regretfully, credit card payments are not accepted. Please make the delegate's name clearly legible on all money transfers. [] Invoice required / Eine Rechnung wird benoetigt Date / Datum: Signature / Unterschrift: Please send your registration to / Bitte senden Sie Ihre Anmeldung an Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 SCHOLARSHIPS: Two scholarships are available for participation at FLAI'93: The Austrian Federal Ministry for Science and Research has kindly agreed to provide a limited number of scholarships covering the registration fee for the conference and part of the accommodation costs for colleagues from eastern and south-eastern European countries. The scholarships will be awarded during FLAI'93. A regular paid registration that will be refunded is necessary to apply. Application should be sent as early as possible. In cases where advance payment is not possible, please get in contact with the conference chairpersons. The organizers reserve the right to split scholarships among two or more applicants. FLAI'93 is officially sponsored by ECCAI, the European Coordinating Committee for Artificial Intelligence. Therefore members of ECCAI organizations applying to ECCAI's Travel Award fund will receive preferential treatment when applying to attend FLAI'93. Details follow in this message. ------------------------------------------------------------------------- Best regards, and see you in Linz at FLAI'93, Wolfgang SLANY FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Ms. Heidi MILOS at +43-1-5055304 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send SUBSCRIBE FUZZY-MAIL Your Real Name as a message to | | listserver@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like HELP to listserver@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From schiffer@faw.uni-ulm.de Mon Apr 19 11:28:44 1993 id AA13267; Mon, 19 Apr 1993 11:25:46 -0500 Date: Mon, 19 Apr 1993 11:25:46 -0500 From: schiffer@faw.uni-ulm.de (Jutta Schiffers) Subject: Looking for information about LIFE program? Dear Colleagues, could anybody please send me some informations about the japanese LIFE program? I need any hints or references about the points Fuzzy computing Intelligent interfaces Fuzzy associative memory Fuzzy image processing Intelligent Robotics. Thanks and best regards , Jutta Schiffers From wsi@altair Wed Apr 21 09:33:49 1993 Date: Wed, 21 Apr 93 09:31:23 +0200 From: wsi@altair (Wolfgang Slany) Subject: FAQ: Fuzzy Logic and Fuzzy Expert Systems Frequently Asked Questions Mark Kantrowitz (mkant+@cs.cmu.edu) just posted his fuzzy-faq (Fuzzy Logic and Fuzzy Expert Systems Frequently Asked Questions) list to the news-group comp.ai.fuzzy: If you want to get the current version, please continue to read. ----- Begin Included Message ----- >From mkant+@cs.cmu.edu (Mark Kantrowitz) Subject: FAQ: Fuzzy Logic and Fuzzy Expert Systems 1/1 [Monthly posting] Summary: Answers to Frequently Asked Fuzzy Questions. Read before posting. Archive-name: fuzzy-faq/part1 Last-modified: Fri Apr 16 17:29:33 1993 by Mark Kantrowitz *** This is the draft of the Fuzzy FAQ posting. If you have any comments, *** corrections, or additions, please send mail to mkant+fuzzy-faq@cs.cmu.edu. *** The FAQ will begin being posted monthly on the 13th of May. --mark ;;; ***************************************************************** ;;; Answers to Questions about Fuzzy Logic and Fuzzy Expert Systems * ;;; ***************************************************************** ;;; Written by Erik Horstkotte, Cliff Joslyn, and Mark Kantrowitz ;;; fuzzy-faq.text -- 57099 bytes Contributions and corrections should be sent to the mailing list mkant+fuzzy-faq@cs.cmu.edu. Note that the mkant+fuzzy-faq@cs.cmu.edu mailing list is for discussion of the content of the FAQ posting only. It is not the place to ask questions about fuzzy logic and fuzzy expert systems; use the newsgroup comp.ai.fuzzy for that. If a question appears frequently in that forum, it will get added to the FAQ list. The original version of this FAQ posting was prepared by Erik Horstkotte of Togai InfraLogic , with significant contributions by Cliff Joslyn . The FAQ is maintained by Mark Kantrowitz with advice from Erik and Cliff. To reach us, send mail to mkant+fuzzy-faq@cs.cmu.edu. Thanks also go to Michael Arras for running the vote which resulted in the creation of comp.ai.fuzzy, Yokichi Tanaka for help in putting the FAQ together, and Walter Hafner , Satoru Isaka , Henrik Legind Larsen , Tom Parish , Liliane Peters , Naji Rizk , Peter Stegmaier , Prof. J.L. Verdegay , and Dr. John Yen for contributions to the initial contents of the FAQ. This FAQ is posted once a month on the 13th of the month. In between postings, the latest version of this FAQ is available by anonymous ftp from CMU: To obtain the file from CMU, connect by anonymous ftp to any CMU CS machine (e.g., ftp.cs.cmu.edu [128.2.206.173]), using username "anonymous" and password "name@host". The file fuzzy-faq.text, is located in the directory /afs/cs.cmu.edu/user/mkant/Public/AI/ [Note: You must cd to this directory in one atomic operation, as some of the superior directories on the path are protected from access by anonymous ftp.] If your site runs the Andrew File System, you can just cp the file directly without bothering with FTP. The FAQ postings are also archived in the periodic posting archive on rtfm.mit.edu [18.70.0.226]. Look in the anonymous ftp directory /pub/usenet/news.answers/ in the subdirectory fuzzy-faq/. If you do not have anonymous ftp access, you can access the archive by mail server as well. Send an E-mail message to mail-server@rtfm.mit.edu with "help" and "index" in the body on separate lines for more information. Table of Contents: [1] What is the purpose of this newsgroup? [2] What is fuzzy logic? [3] Where is fuzzy logic used? [4] What is a fuzzy expert system? [5] Where are fuzzy expert systems used? [6] What is fuzzy control? [7] What are fuzzy numbers and fuzzy arithmetic? [8] Isn't "fuzzy logic" an inherent contradiction? Why would anyone want to fuzzify logic? [9] How are membership values determined? [10] What is the relationship between fuzzy truth values and probabilities? [11] Are there fuzzy state machines? [12] What is possibility theory? [13] How can I get a copy of the proceedings for ? [14] Fuzzy BBS Systems, Mail-servers and FTP Repositories [15] Mailing Lists [16] Bibliography [17] Journals [18] Professional Organizations [19] Companies Supplying Fuzzy Tools [20] Fuzzy Researchers (body of message deleted to avoid waste of bandwith) ----- End Included Message ----- From wsi@altair Wed Apr 21 18:54:46 1993 Date: Wed, 21 Apr 93 18:52:20 +0200 From: wsi@altair (Wolfgang Slany) Subject: CFP FUZZY LOGIC FOR COMMERCIAL AND INDUSTRIAL APPLICATIONS WS at FLAI'93 OeGAI FLAI'93 28. Juni 1993 FLAI'93 - Fuzzy Logic in Artificial Intelligence Eighth Austrian Artificial Intelligence Conference FLAI'93 Workshop FUZZY LOGIC FUER WIRTSCHAFT UND INDUSTRIE FUZZY LOGIC FOR COMMERCIAL AND INDUSTRIAL APPLICATIONS 28. Juni 1993, Bildungshaus St. Magdalena, Linz, Austria Call for Papers and Participation Ankuendigung und Einladung fuer Workshop-Beitraege Sprachen: Deutsch/Englisch Languages: German/English Overview in English The FLAI'93 workshop "Industrial and Commercial Applications of Fuzzy Logic" provides an informal forum to conference participants to address key issues in industrial and commercial applications of fuzzy logic. The objective of the workshop is to discuss emerging applications of fuzzy logic based technology, to start a dialog on exploring new ways of applying fuzzy logic and ways to increase the role of fuzzy logic in engineering and decision-making disciplines. Topics of the workshop include reports on work in progress and on the current state of the art from the following fields: automation and industrial control, ecology, decision support, pattern recognition, image generation ... Fuzzy logic based technology is already impacting the way products are developed in the automation and industrial control market and in the consumer products market causing changes in the product life-cycle, the development costs and time to market. What do these changes mean to companies in these markets? And, can we expect this impact to spread into other markets, like for example the financial services sector? The key to understanding the impact of fuzzy logic based technologies is understanding that fuzzy logic is a true paradigm shift. The shift is bound to impact the way how new products are developed and how long it takes to market them. A considerable reduction of development costs is to be expected for some products, for example household appliances. We may see new markets emerge as fuzzy logic based technologies become commercially available. Commercial aspects, technology assessment as well as comparative studies on these effects are part of the workshop. The last part is devoted to practical problems. Problem areas, where fuzzy technology is expected (or known) to be less appropriate and successful, should be identified and discussed with the goal of sharing experiences and finding ways to overcome such obstacles by, for example, hybrid techniques. Finally, especially for companies entering the field, development methodology and phase models for fuzzy system development are of considerable interest and can lower the entry barrier and the entry cost. Overview in German / Uebersicht auf Deutsch Der FLAI'93 Workshop "Fuzzy Logic fuer Wirtschaft und Industrie" findet im Rahmen der 8. Austrian Artificial Intelligence Konferenz am 28. Juni im Bildungshaus St. Magdalena, Linz statt. Konferenzteilnehmer finden im Rahmen dieses Workshops Gelegenheit, Anwendungen von Fuzzy Logic, Beurteilung der Wirtschaftlichkeit von Fuzzy-Logic Anwendungen, vergleichende Studien, Probleme und Kritik in einem informellen Rahmen zu praesentieren und zu diskutieren. Als Workshopsprache ist Deutsch vorgesehen, die Vortragsdauer fuer einen Workshopbeitrag ist auf 20 Minuten Vortrag mit anschliessender Diskussion (insgesamt 30 Minuten) beschraenkt. Workshop Themen o Anwendungen von Fuzzy Logic zum Beispiel aus einem der folgenden Gebiete: Finanzdienstleistungsbereich, Entscheidungsunterstuetzende Systeme, Industrie, Handel, Marketing, Regelungstechnik, Produktionsplanung und -steuerung, Oekologie, Umweltschutz, ... o Probleme und Kritik. o Wirtschaftliche Aspekte. o Vergleichenden Studien. o Entwicklungsmethodik und Vorgehensmodelle. Beitraege Workshopteilnehmer werden aufgefordert, Beitraege zu einem dieser Themen mit einer maximalen Laenge von 10 DIN-A4 Seiten einschliesslich Titel, Abbildungen, Tabellen und Referenzen einzureichen. 2 Kopien der Beitraege sind an einen der Organisatoren (Adresse unten) zu schicken. Angenommene Beitraege werden in einem Workshop-Band den Workshop-Teilnehmern zur Verfuegung gestellt. Wichtige Termine Einreichen von Beitraegen bis spaetestens 1. Mai 1993. Benachrichtigung ueber Annahme bis 15. Mai 1993. Druckfertige Beitraege bis spaetestens 1. Juni 1993. Workshop Organisatoren Ing. Peter Kotauczek BEKO GmbH Weiszgerberlaende 38 A-1030 Wien, Oesterreich Tel: +43 1 713 37 33 Fax: +43 1 713 31 20 46 Dr. Andreas Geyer-Schulz Lehrstuhl fuer Betriebswirtschaftslehre/Wirtschaftsinformatik WISO-Fakultaet, Universitaet Augsburg Memmingerstrasse 18, D-8900 Augsburg, Deutschland and Dr. Andreas Geyer-Schulz Abteilung fuer Angewandte Informatik insbesondere Betriebsinformatik Institut fuer Informationsverarbeitung und Informationswirtschaft Wirtschaftsuniversitaet Wien Augasse 2-6, A-1090 Wien, Oesterreich Tel: +43 1 330 36 36-31 Fax: +43 1 330 36 36-10 E-mail: geyers@uxe.wu-wien.ac.at ------------------------------------------------------------------------- Eighth Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Call for Participation and Registration Form General Information Flai'93 will be a forum for presentation of new results in research, development and applications of Fuzzy Logic in Artificial Intelligence. The conference will favor the sharing of information between researchers and practitioners, and outline future developments of Fuzzy Logic applications in Artificial Intelligence. The conference will take place in a cozy, seminar-like atmosphere on a hill overlooking Linz. The conference language will be English for the Scientific Program and the Workshops, the Tutorials will be given in German. Program Workshops June 28, 1993 * Workshop for Doctoral Students in Fuzzy-Based Systems * Fuzzy Logic for Commercial and Industrial Applications (English/German) / Fuzzy Logic fuer Wirtschaft und Industrie (Deutsch/Englisch) * Karl Menger, Fuzzy Logic and Artificial Intelligence - An Experiment in Reflection * Fuzzy Scheduling Systems Detailed information on the workshops follows. Persons wishing to attend a workshop must register to the technical program of FLAI'93 and contact the workshop organizers. Paper contributions are welcome, please send them directly to one of the corresponding workshop organizers. Tutorials June 28, 1993 (auf Deutsch / in German) * Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH Aachen * Nachmittag: Fuzzy Control - Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig Genaue Informationen zu den Tutorials folgen. Scientific Program June 29-30, 1993 Invited Talks: * The Role of Fuzzy Logic and Soft Computing in the Conception and Design of Intelligent Systems, Lotfi A. Zadeh, University of California, Berkeley * Contextual Approach for AI Systems Development, Irina Ezhkova, Russian Academy of Sciences, Moscow Regular Paper Sessions: * Neural Networks, Genetic Algorithms, other learning paradigms, and Fuzzy Logic * Expert Systems and Fuzzy Logic * Robotics, Control, and Fuzzy Logic * Medicine and Fuzzy Logic * Driving with Fuzzy Logic * Theoretical Issues Panels and Special Sessions: * Panel 1: FL&AI: differences and meeting points. * Panel 2: A critical view on what is going on in Fuzzy Logic and Artificial Intelligence: Hit, Hype or both? * Workshop overview session. * ESPRIT Session: The session will present the EC view on the structure and content of Fuzzy Logic or Artificial Intelligence-related projects recently accepted in the ESPRIT program. Persons interested in participating in panels or other special sessions should contact the conference chairpersons. Details on the scientific program will be sent out to you before the conference. Exhibitions June 28-30, 1993 * There will be an exhibition on recent books relevant to the conference's theme "Fuzzy Logic in Artificial Intelligence". Suggestions for books to be exhibited are welcome. * Another exhibition will display Fuzzy Logic and Artificial Intelligence related hard- and software. Companies or individuals wishing to participate should contact the organizers. Conference Organizer Oesterreichische Gesellschaft fuer Artificial Intelligence / Austrian Society for Artificial Intelligence Conference Chairpersons Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 Wolfgang Slany Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6123 Fax: +43-1-5055304 Program Committee K.-P. Adlassnig (Austria) D. Dubois (France) M. Fedrizzi (Italy) A. Geyer-Schulz (Austria/Germany) V. H. Haase (Austria) R. Kruse (Germany) R. Lopez de Mantaras (Spain) M. Reinfrank (Germany) Ph. Smets (Belgium) H. Takagi (Japan/USA) R. R. Yager (USA) M. Zemankova (USA) H.-J. Zimmermann (Germany) Workshop Organizers Rainer Born (Johannes Kepler Universitaet Linz) Johann Gamper (Universitaet Wien), Andreas Geyer-Schulz (Wirtschaftsuniversitaet Wien / Universitaet Augsburg) Roger Kerr (Technische Universitaet Wien / University of New South Wales) Peter Kotauczek (BEKO GesmbH., Wien) Bernhard Moser (Universitaet Salzburg) Cooperating Institutions Fuzzy Logic Laboratorium Linz Christian Doppler Labor fuer Expertensysteme, Wien Supporting Companies and Institutions BEKO - Ing. P. Kotauczek GesmbH., Wien Technologie und Marketing GesmbH., Linz European Coordinating Committee for Artificial Intelligence ************************************************* * For a free INVITATION PROGRAM please contact: * ************************************************* by E-mail: flai93_info@vexpert.dbai.tuwien.ac.at (automatic reply with latest information), or Ms. Heidi Milos - FLAI'93 Christian Doppler Labor fuer Expertensysteme Institut fuer Informationssysteme (Nr. 184/2) Technische Universitaet Wien Paniglg. 16, A-1040 Vienna, Austria (Europe) Tel: +43-1-58801-6125 Fax: +43-1-5055304 E-mail: flai93_secr@vexpert.dbai.tuwien.ac.at -------------------Cut-Here-For-Registration-Form------------------- REGISTRATION FORM - FLAI'93 - ANMELDUNGSFORMULAR Eighth Austrian Artificial Intelligence Conference FLAI'93 FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE June 28-30, 1993 Bildungszentrum St. Magdalena, Linz, Austria (Europe) Full name [] Ms. [] Mr. [] Dr. [] Prof.: Name as you would like it on your badge: Address: Telephone: Fax: E-Mail: Tutorials June 28, 1993 (auf Deutsch / in German, mit Mittagessen) [] Vormittag: Fuzzy Logic und ihre Anwendungen (speziell in Expertensystemen) Prof. Dr. Dr. h.c. Hans-Juergen Zimmermann, RWTH/ELITE Aachen ATS 2,000.- [] Nachmittag: Fuzzy Control-Grundlagen (inkl. "Kruse, Gebhardt, Klawonn: Fuzzy Systeme, Teubner Verlag, 1993") Prof. Dr. Rudolf Kruse, Technische Universitaet Braunschweig ATS 2,200.- [] Ermaessigte Gebuehr fuer Teilnehmer an beiden Tutorials ATS 3,700.- Technical Program June 28-30, 1993 (including workshops, proceedings, receptions and lunches) until May 14, 1993: [] ATS 1,900.- [] Full-time student* ATS 800.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. after May 14, 1993: [] ATS 2,300.- [] Full-time student* ATS 1,000.- * A copy of a picture student identification card or an official letter from the university indicating full-time student status and age (up to 29 years old) must accompany this registration form. [] for participants of tutorials / fuer Tutorialteilnehmer ATS 1,500.- [] OEGAI members: subtract ATS 150.- (applies only once) Bed and breakfast at the conference site / Unterkunft und Fruehstueck am Tagungsort Accommodation at the conference site is ATS 500.- per night and person. Very few double rooms are available directly at the conference site. [] Please reserve [ ] single rooms [ ] double rooms Arrival date: Departure date: [] ATS 500.- x [ ] nights x [ ] persons = =====> TOTAL in Austrian Schillings (ATS) = _______________________________________________________________________ Method of Payment / Zahlungsmodus [] Transfer to bank account / Ueberweisung auf Konto [] Postal Giro account "OEGAI", no. 92,016-129, Vienna. [] Die Erste Oesterreichische Spar-Casse-Bank Wien "OEGAI", Konto-Nr. 004-71186, BLZ 20111 [] Eurocheque / Euroscheck (Please make cheque payable to "OEGAI") All cheques should be in Austrian Schillings (ATS 100.- corresponds to approximately US$ 8.55). Payment must accompany registration. In order to keep registration costs down, regretfully, credit card payments are not accepted. Please make the delegate's name clearly legible on all money transfers. [] Invoice required / Eine Rechnung wird benoetigt Date / Datum: Signature / Unterschrift: Please send your registration to / Bitte senden Sie Ihre Anmeldung an Erich Peter Klement Fuzzy Logic Laboratorium Linz Institut fuer Mathematik Johannes Kepler Universitaet A-4040 Linz, Austria (Europe) Tel: +43-732-2468-9151 Fax: +43-732-2468-10 SCHOLARSHIPS: Two scholarships are available for participation at FLAI'93: The Austrian Federal Ministry for Science and Research has kindly agreed to provide a limited number of scholarships covering the registration fee for the conference and part of the accommodation costs for colleagues from eastern and south-eastern European countries. The scholarships will be awarded during FLAI'93. A regular paid registration that will be refunded is necessary to apply. Application should be sent as early as possible. In cases where advance payment is not possible, please get in contact with the conference chairpersons. The organizers reserve the right to split scholarships among two or more applicants. FLAI'93 is officially sponsored by ECCAI, the European Coordinating Committee for Artificial Intelligence. Therefore members of ECCAI organizations applying to ECCAI's Travel Award fund will receive preferential treatment when applying to attend FLAI'93. Details follow in this message. -------------------------------------------------------------------- Best regards, and see you in Linz at FLAI'93, Wolfgang SLANY FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Ms. Heidi MILOS at +43-1-5055304 ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ | Send SUBSCRIBE FUZZY-MAIL Your Real Name as a message to | | listserver@vexpert.dbai.tuwien.ac.at to subscribe to the European | | fuzzy-mail list. Send all messages that you want to be distributed to | | the subscribers to fuzzy-mail@vexpert.dbai.tuwien.ac.at, and send all | | control commands like HELP to listserver@vexpert.dbai.tuwien.ac.at | ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ From BENEDIKT@ZDVAXA.UNA.AC.AT Thu Apr 22 09:13:41 1993 <01GXB1OT4U6O96VK3N@Pap.UniVie.AC.AT>; Thu, 22 Apr 1993 09:13 GMT+0200 Date: Thu, 22 Apr 1993 09:13 GMT+0200 From: BENEDIKT@ZDVAXA.UNA.AC.AT Subject: FLAI93-exhibition An exhibition on books will be organized at the forthcoming conference on "Fuzzy Logic in Artificial Intelligence" (FLAI 93), Linz, Austria. If you know of any recent books that are of particular interest to the participants, your suggestions would be of great help. Topics include Neural Networks, Genetic Algorithms, Expert Systems, Fuzzy Logic (Theory and Application). Any suggestions are welcome. Send references to "benedikt@zdvaxa.una.ac.at". Please, DO NOT use "fuzzy-mail", "NAFIPS-L", "comp.ai.fuzzy", etc. Thank you in advance Best regards, and see you in Linz at FLAI'93, Josef Benedikt Email: benedikt@zdvaxa.una.ac.at FUZZY LOGIC IN ARTIFICIAL INTELLIGENCE, LINZ (AUSTRIA) June 28-30, 1993 Latest Automatic News: flai93_info@vexpert.dbai.tuwien.ac.at Administrative Stuff: flai93_secr@vexpert.dbai.tuwien.ac.at Conference Chairpersons: flai93@vexpert.dbai.tuwien.ac.at or fax to Ms. Heidi MILOS at +43-1-5055304 From fathi@jupiter.informatik.uni-dortmund.de Mon Apr 26 11:22:23 1993 by waldorf.informatik.uni-dortmund.de with SMTP (5.65+/UniDo 1.0.27) id AA24547; Mon, 26 Apr 93 11:22:11 +0200 From: Madjid Fathi-Torbaghan Date: Mon, 26 Apr 93 11:22:09 +0200 =========================================================== | | | CALL FOR PAPERS | | =============== | | | | 1994 ACM Symposium on Applied Computing (SAC'94) | | | | | | TRACK ON FUZZY LOGIC IN APPLICATIONS | | ------------------------------------ | | | | Phoenix Civic Plaza, Phoenix, Arizona, USA | | | | March 6-8, 1994 | | | =========================================================== SAC'94 is the annual conference of the ACM Special Interest Group on Applied Computing (SIGAPP), APL (SIGAPL), Biomedical Computing (SIGBIO), Business Information Technology (SIGBIT), Computer Uses in Education (SIGCUE), Forth (SIGFORTH), and Small and Personal Computer (SIGSMALL/PC). For the past nine years, SAC has become a primary forum for applied computing practitioners and researchers. Once again SAC'94 will be held in conjunction with the 1994 ACM Computer Science Conference (CSC'94). Fuzzy Logic in Applications is one of the major tracks in SAC. The purpose of this track is to provide a forum for the interchange of ideas, research, development activities, and applications among academic and practitioners in the areas related to Fuzzy Logic in Applications. State-of-the-art and state-of-the-practice original papers relevant to the track themes as well as panel proposals are solicited. RELEVANT TOPICS: Applications of Fuzzy Systems to: - System Control - Signal Processing - Intelligent Information Systems - Image Understanding - Case-Based Reasoning - Pattern Recognition - Decision Making and Analysis - Robotics and Automation - Modelling - Medical Diagnostic and MRI - Databases and Information Retrieval - Evolutionary Computation - Neural Systems IMPORTANT DATES: Submission of draft papers: 17.09.1993 Notification of acceptance: 01.11.1993 Camera-ready copy due: 20.11.1993 TRACK CHAIR: Madjid Fathi FB Informatik, LS1 P.O.BOX 500 500 University of Dortmund D-4600 Dortmund 50 Germany Tel: +49231-7556372 FAX: +49231-7556555 Email: fathi@ls1.informatik.uni-dortmund.de HONORARY ADVISOR : Lotfi A. Zadeh, University of California, Berkeley TRACK ADVISORY: Y. Attikiouzel, Univ. of Western Australia H. Berenji, NASA Ames Division, AI Research, NY, USA M. Jamshidi, Univ. of New Mexico, NM, USA A. Kandel, Univ. of South Florida, USA R. Kruse, Univ. of Braunschweig, Germany E.H. Mamdani, Univ. of London, GB M. Masetti, Univ. of Bologna, Italy H. Prade, Univ. of Paul Sabatier, France B. Reusch, Univ. of Dortmund, Germany E.H. Ruspini, SRI International, USA H. Tanaka, Univ. of Osaka, Japan L. Valverde, Univ. of de les Illes Baleares, Spain R.R. Yager, Iona College, Editor in-chief, USA H.J. Zimmermann, Univ. of Aachen, Germany GUIDELINES FOR SUBMISSION Several Categories of papers will be considered for presentation and publication including: (i) original and unpublished research articles, (ii) Reports of applications in - business, - government, - industrie, - arts, - science and - engineering. Accepted papers will be published in the ACM/SAC'94 Conference Proceedings to be printed by the ACM Press. In order to facilitate the blind external review process, submission guidelines must be strictly adhered to: - Submit 5 copies of your manuscript to the track chair. - Authors names and addresses MUST NOT appear in the body of the paper, self-reference must be in the third person, attribution to the author(s) must be in the form of "author", and bibliographical entries by the author(s) must also be in the form of "author". - The body of the paper should not exceed 5.000 words (approximately 20 doubled-spaced pages). - A seperate cover sheet shoeld be attached to each copy, containing - the title of the paper, - the author(s) and affiliation(s), - and the address (including e-mail address and fax number, if available) to which correspondence should be sent. - Panel proposals must include abstract of the topics and a copy of resume/vita of the moderator. From NAFIPS-L@GSUVM1.BITNET Mon Apr 26 18:45:57 1993 AWIUNI11.EDVZ.UNIVIE.AC.AT (LMail V1.1d/1.7f) with BSMTP id 9659; Mon, 26 Apr 1993 18:45:39 +0100 Date: Mon, 26 Apr 1993 15:43:40 +0100 From: Francis Heylighen Subject: CFP: Cybernetics of Knowledge Symposium, EMCSR'94 (Vienna) HUMANIST@BROWNVM.bitnet, HUMEVO@GWUVM.bitnet, KONFER-L@TREARN.bitnet, NAC@NDSUVM1.bitnet, MPSYCH-L@BROWNVM.bitnet, NAFIPS-L@GSUVM1.bitnet, COMP-SOC@LIMBO.INTUITIVE.COM, NEUR-SCI@IRLEARN.bitnet, NEURO1-L@UICVM.bitnet, NL-KR@RPITSVM.bitnet, NSP-L@RPITSVM.BITNET, PHILCOMM@RPITSVM.bitnet, PMC-TALK@NCSUVM.bitnet, QUALRS-L@UGA.bitnet, REACH@UCSBVM.bitnet, SKEPTIC@YORKVM1.bitnet, SYSCI-L@UOTTAWA.bitnet, THEORYNT@NDSUVM1.bitnet CALL FOR PAPERS ************************************************************* * Symposium : * * CYBERNETIC PRINCIPLES OF KNOWLEDGE DEVELOPMENT * ************************************************************* as part of the 12th European Meeting on Cybernetics and Systems Research EMCSR'94, Vienna, April 5-8, 1994 About the Symposium: ==================== A symposium in collaboration with the Principia Cybernetica Project (PCP) will be held at EMCSR'94. Chairmen are F. Heylighen (representing PCP) and S. Umpleby. The theme is a cybernetic perspective on the creation and evolution of knowledge, with special emphasis on methods of model construction in science. We wish to focus on both fundamental principles (what is knowledge, what is science, which criteria distinguish adequate knowledge, how does knowledge originate and develop, what is the role of induction, abduction, blind variation, selection, recombination, memetic spreading...) and practical applications (which methods and tools can help us to steer or improve the generation of knowledge). The latter is especially important for the Principia Cybernetica Project, as a collaborative computer-supported attempt to develop philosophical knowledge. The EMCSR meetings are possibly the most important and best organized large congresses in their domain. Though they are traditionally called "European", they really bring together researchers from all continents, albeit with a relative large proportion of people from Central and Eastern Europe. Among the distinctive features are the high quality, well-distributed Proceedings, which are available at the start of the Conference. This implies that papers should be submitted (to the Congress secretariat, not to the chairpersons!) quite a while before the start of the conference. The official CFP and preliminary programme of EMCSR'94 are appended below. After the succesful organization of a symposium at the 8th World Congress of Systems and Cybernetics (New York, 1990), of the 1st Workshop of the Principia Cybernetica Project (Brussels, 1991), and of a Symposium at the 13th Int. Congress on Cybernetics (Namur, 1992), this will be the fourth official activity of the Principia Cybernetica Project. For more information about the Symposium (not for paper submissions), contact: Dr. Francis Heylighen PO-PESP, Free University of Brussels, Pleinlaan 2, B-1050 Brussels, Belgium. Fax: +32-2-641 24 89. E-mail: fheyligh@vnet3.vub.ac.be. Prof. Stuart Umpleby Dep. of Management Science, School of Business and Public Management, George Washington University, Washington DC 20052, USA. Fax: +1-202-994 4930. E-mail: umpleby@gwuvm.bitnet. About Principia Cybernetica: ============================ The Principia Cybernetica Project (PCP) is a collaborative attempt to develop a complete cybernetic and evolutionary philosophy. Such a philosophical system should arise from a transdisciplinary unification and foundation of the domain of Systems Theory and Cybernetics. Similar to the metamathematical character of Whitehead and Russell's "Principia Mathematica", PCP is meta-cybernetical in that we intend to use cybernetic tools and methods to analyze and develop cybernetic theory. These include the computer-based tools of hypertext, electronic mail, electronic publishing, and knowledge structuring software. They are meant to support the process of collaborative theory-building by a variety of contributors, with different backgrounds and living in different parts of the world. PCP will thus naturally develop in the "cyberspace" of data shared through interlinked electronic networks, as implemented for example in the World-Wide Web distributed hypertext software. PCP is to be developed as a dynamic, multi-dimensional conceptual network. The basic architecture consists of nodes, containing expositions and definitions of concepts, connected by links, representing the associations that exist between the concepts. Both nodes and links can belong to different types, expressing different semantic and practical categories. As its name implies, PCP will focus on the clarification of fundamental concepts and principles of the broadly defined domain of cybernetics and systems, which includes related disciplines such as the "sciences of complexity", AI, ALife, Cognitive Science, Evolutionary Systems, etc. Concepts include: Complexity, Information, Entropy, System, Freedom, Control, Self-organization, Emergence, etc. Principles include Natural Selection, and the Laws of Requisite Variety, of Requisite Hierarchy, and of Regulatory Models. The PCP philosophical system is to be seen as a clearly thought out and well-formulated, global "world view", integrating the different domains of knowledge and experience. It should provide an answer to the basic questions: "Who am I? Where do I come from? Where am I going to?". The PCP philosophy is systemic and evolutionary, based on the spontaneous emergence of higher levels of organization or control (metasystem transitions) through blind variation and natural selection. It includes: a) a metaphysics, based on processes or actions as ontological primitives, b) an epistemology, which understands knowledge as constructed by the subject or group, but undergoing selection by the environment; c) an ethics, with survival and the continuance of the process of evolution as supreme values. Philosophy and implementation of PCP are united by their common framework based on cybernetic and evolutionary principles: the computer-support system is intended to amplify the spontaneous development of knowledge which forms the main theme of the philosophy. PCP is managed by a board of editors, presently: V. Turchin [CUNY, New York], C. Joslyn [NASA and SUNY Binghamton] and F. Heylighen [Free Univ. of Brussels]. Contributors are kept informed through the PRNCYB-L electronic mailing list, and the Principia Cybernetica Newsletter. Further activities of PCP are publications in journals or books, and the organization of meetings or symposia. More information about PCP is available by anonymous ftp to is1.vub.ac.be, directory /pub/projects/Principia_Cybernetica, or by email request to fheyligh@vnet3.vub.ac.be. About EMCSR'94: =============== Twelfth European Meeting on Cybernetics and Systems Research April 5-8, 1994 at the University of Vienna (Main Building) Organizers: ----------- Austrian Society for Cybernetic Studies in co-operation with: University of Vienna, Department of Medical Cybernetics and Artificial Intelligence, and: International Federation for Systems Research Chairman: Robert Trappl, President of the Austrian Society for Cybernetic Studies Conference fee : ---------------- Contributors : AS 2500 if paid before January 31, 1994 AS 3200 if paid later Participants : AS 3500 if paid before January 31, 1994 AS 4200 if paid later (AS 100 = about $ 9) The conference fee includes participation in the Twelfth European Meeting, attendance at official receptions, and the volume of the proceedings available at the Meeting. Please send cheque, or transfer the amount free of charges for beneficiary to our account no. 0026-34400/00 at Creditanstalt-Bankverein Vienna. Please state your name clearly. About the Congress: ------------------- The international support of the European Meetings on Cybernetics and Systems Research held in Austria in 1972, 1974, 1976, 1978, 1980, 1982, 1984, 1986, 1988, 1990 and 1992 (when 300 scientists from more than 30 countries met to present, hear and discuss 210 papers) encouraged the Council of the Austrian Society for Cybernetic Studies (OSGK) to organize a similar meeting in 1994 to keep pace with continued rapid developments in related fields. A number of Symposia will be arranged and we are grateful to colleagues who have undertaken the task of preparing these events. As on the earlier occasions, eminent speakers of international reputation will present latest research results at daily plenary sessions. The Proceedings of the 10th and 11th European Meetings on Cybernetics and Systems Research, edited by R. Trappl, have been published by World Scientific, Singapore as : CYBERNETICS AND SYSTEMS '90 (1 vol., 1107 p.) CYBERNETICS AND SYSTEMS '92 (2 vols., 1685 p.) Symposia: --------- A General Systems Methodology G.J.Klir, USA B Advances in Mathematical Systems Theory M.Peschel, Germany & F.Pichler, Austria C Fuzzy Sets, Approximate Reasoning & Knowledge Based Systems C.Carlsson, Finland, K-P.Adlassnig, Austria & E.P.Klement, Austria D Designing and Systems, and Their Education B.Banathy, USA, W.Gasparski, Poland & G.Goldschmidt, Israel E Humanity, Architecture and Conceptualization G.Pask, UK, & G.de Zeeuw, Netherlands F Biocybernetics and Mathematical Biology L.M.Ricciardi, Italy G Systems and Ecology F.J.Radermacher, Germany & K.Freda, Austria H Cybernetics and Informatics in Medicine G.Gell, Austria & G.Porenta, Austria I Cybernetics of Socio-Economic Systems K.Balkus, USA & O.Ladanyi, Austria J Systems, Management and Organization G.Broekstra, Netherlands & R.Hough, USA K Cybernetics of National Development P.Ballonoff, USA, T.Koizumi, USA & S.A.Umpleby, USA L Communication and Computers A M.Tjoa, Austria M Intelligent Autonomous Systems J.W.Rozenblit, USA & H.Praehofer, Austria N Cybernetic Principles of Knowledge Development F.Heylighen, Belgium & S.A.Umpleby, USA O Cybernetics, Systems & Psychotherapy M.Okuyama, Japan & H.Koizumi, USA P Artificial Neural Networks and Adaptive Systems S.Grossberg, USA & G.Dorffner, Austria Q Artificial Intelligence and Cognitive Science V.Marik, Czechia & R.Born, Austria R Artificial Intelligence & Systems Science for Peace Research S.Unseld, Switzerland & R.Trappl, Austria Submission of papers : ---------------------- Acceptance of contributions will be determined on the basis of Draft Final Papers. These Papers must not exceed 7 single-spaced A4 pages (maximum 50 lines, final size will be 8.5 x 6 inch), in English. They have to contain the final text to be submitted, including graphs and pictures. However, these need not be of reproducible quality. The Draft Final Paper must carry the title, author(s) name(s), and affiliation in this order. Please specify the symposium in which you would like to present your paper. Each scientist shall submit only one paper. Please send three copies of the Draft Final Paper to the Conference Secretariat (not to symposia chairpersons!). DEADLINE FOR SUBMISSION : October 8, 1993 In order to enable careful refereeing, Draft Final Papers received after the deadline cannot be considered. FINAL PAPERS : Authors will be notified about acceptance no later than November 13, 1993. They will be provided by the conference secretariat at the same time with the detailed instructions for the preparation of the final paper. PRESENTATION : It is understood that the paper is presented personally at the Meeting by the contributor. HOTEL ACCOMMODATIONS will be handled by Oesterreichisches Verkehrsbuero, Kongressabteilung, Opernring 5, A-1010 Vienna, phone +43-1-58800-113, fax +3-1-5867127, telex 111 222. Reservation cards will be sent to all those returning the attached registration form. SCHOLARSHIPS : The Austrian Federal Ministry for Science and Research has kindly agreed to provide a limited number of scholarships covering the registration fee for the conference and part of the accommodation costs for colleagues from eastern and south-eastern European countries. Applications should be sent to the Conference Secretariat before October 8, 1993. For further information about the Congress, contact: EMCSR 94 - Secretariat : Oesterreichische Studiengesellschaft fuer Kybernetik A-1010 Wien 1, Schottengasse 3, Austria. Phone : +43-1-53532810 Fax : +43-1-5320652 E-mail : sec@ai.univie.ac.at _______________________________________________________________ REGISTRATION FORM _______________________________________________________________ EMCSR-94 Twelfth European Meeting on Cybernetics and Systems Research Please return to : Austrian Society for Cybernetic Studies Schottengasse 3, A-1010 Vienna, AUSTRIA (EUROPE) o I plan to attend the Meeting o I intend to submit a paper to Symposium ... o I enclose the Draft Final Paper o My Draft Final Paper will arrive prior to October 8, 1993 o My cheque for AS .... covering the Conference Fee is enclosed o I have transferred AS .... to your account 0026-34400/00 at Creditanstalt Vienna o I shall not be at the Meeting but am interested to receive particulars of the Proceedings Name : Prof./Dr./Ms./Mr. ...................................... Address : ..................................................... ............................................................... Fax : .............................E-Mail : ................... Date : ....... Signature: _______________________________________________________________ From daugher@chisholm.cs.tamu.edu Tue Apr 27 19:12:21 1993 Date: Tue, 27 Apr 93 12:11:55 -0500 From: daugher@chisholm.cs.tamu.edu (Walter C. Daugherity) Subject: Call for Papers: Industrial Fuzzy Control & Intelligent Systems Call for Papers Third International Conference on Industrial Fuzzy Control & Intelligent Systems Sponsored by Center for Fuzzy Logic and Intelligent Systems Research Texas A&M University December 1-3, 1993 Hilton Hotel, College Station, Texas Honorary Chair L.A. Zadeh Conference Co-Chairs R. Langari J. Yen Local Arrangement Chair N. Kehtarnaraz Exhibit Chair R. Challoo Publicity Chair W. Daugherity Registration Chair W. Zhao Publication Chair J. Painter Panel Chair V. Kreinovich Program Advisory Board J. Bezdek K. Hirota M. Jamshidi E. Ruspini R. Shoureshi M. Sugeno M. Tomizuka R. Volz P. Wang J. Yao L. Zadeh H.-J. Zimmerman Industrial Advisory Board R. Arehart, Exxon, USA B. Barton, TI, USA P. Bonissone, GE, USA B. Butler, Paul-Munroe Engr., USA S. Marsh, Motorola, USA G. Rizzotto, SGS-Thomas, Italy T. Takagi, LIFE, Japan M. Togai, Togai InfraLogic, USA W. Xu, Aptronix, USA T. Yamakawa, FLSI, Japan Program Committee B. Basachi H. Berenji N. Bhatt S. Chiu M. Dryer S. Isaka H. Javaherian F. Lewis A. Nadi I. Panahi A. Parlos F. Pin E. Sanchez-Sinencio N. Stubbs H. Takagi G. Vachtsevanos J. Villareal Hao Ying The goal of this annual conference is to facilitate interaction and cooperation between industrial users of fuzzy logic technology and providers of the technology. All aspects of modeling, design, analysis, implementation, and empirical evaluation of intelligent systems employing fuzzy logic and other complementary technologies (e.g., conventional linear/nonlinear control, neural networks, genetic algorithms, and knowledge-based systems) are of interest. In addition, the 1993 conference will include three featured tracks: (1) automotive (2) manufacturing, automation, and process control (3) neural fuzzy systems The best paper in each track will be given a best paper award. Manuscripts describing novel results from industry are especially encouraged. The conference will publish a formal proceedings. Revised versions of selected papers presented in the conference will be published in a special issue of Journal of Intelligent and Fuzzy Systems. Professor Lotfi A. Zadeh and Professor H.-J. Zimmerman will give keynote speeches at the conference. The conference will also include a one-day tutorial on fuzzy logic and fuzzy control, and an exhibition of fuzzy system development tools and industrial fuzzy control applications. Information for Authors Authors are invited to submit 4 copies of an extended abstract (2-4 pages) no later than June 1, 1993 to one of the Conference Co-Chairs at the following address: Center for Fuzzy Logic and Intelligent Systems Research Room 301, H.R. Bright Bldg. Texas A&M University College Station, TX 77843-3112 Tel: (409)845-5534 Fax: (409)847-8578 email: cfl@cs.tamu.edu Notification of acceptance will be posted by July 15, 1993. Final manuscripts (6 pages) must be received by August 15, 1993 for inclusion in the conference proceedings. From elite@infoac.rmi.de Wed Apr 28 19:37:35 1993 via EUnet EUregio POP Aachen for From: elite@infoac.rmi.de (Stiftung Elite) Date: Wed, 28 Apr 1993 18:16:51 MET DST Subject: Invitation EUFIT '93, September 7-10, 1993 EUFIT '93 First European Congress on Fuzzy and Intelligent Technologies Invitation programme and Registration Foreword by the Honorary Chairman Prof. Dr. Lotfi A. Zadeh, BISC, University of California, Berkeley, USA The decade of the nineties is witnessing a significant paradigm shift in the methodologies of systems analysis, decision analysis, optimization, information processing and control. The shift in question reflects (a) the rapidly growing power of PC's and work stations to process large volumes of information at high speed and low cost; (b) the improvement in non-machine interfaces; and (c) the emergence of effective ways of dealing with complex, large-scale systems through the use of fuzzy logic (FL), neural networks (NN), probabilistic reasoning (PR) and other techniques which may be referred to collectively as soft computing (SC). Viewed as branches of soft computing, FL is concerned in the vain with imprecision, NN with learning and PR with uncertainty. There are substantial areas of overlap between FL, NN, and PR, and in many cases they can be used to advantage in combination. The use of soft computing -- and especially fuzzy logic -- is leading to the development of numerous consumer products, industrial systems, development tools and expert system shells which exhibit a high level of MIQ (Machine Intelligence Quotient). The growing presence of high MIQ systems is likely to have a profound impact on the course of technological development in the years ahead. The EUFIT Conference is intended to provide a forum for the presentation of new ideas and results bearing on the conception, analysis and design of high MIQ systems which can make intelligent decisions in an environment of uncertainty and imprecision. Different disciplines contribute to these developments and they will also benefit directly or indirectly from new, intelligent techniques. Hence I welcome scientists and practitioners from many different countries and different areas here in Aachen for the First European Congress on Fuzzy and Intelligent Technologies. L. A. Zadeh Programme Committee Honorary Chairman: L.A. Zadeh, USA General Chairman: H.-J. Zimmermann, FRG Members: J. Baldwin, GB, J. Bezdek, USA, P. Bonissone, USA, C. Carlsson, FIN, D. Dubois, F, R. Eckmiller, FRG, M. Fedrizzi, I, E.-P. Klement, A, K. Hirota, J, G. Klir, USA, L. Koczy, H, E.H. Mamdani, GB, A. Ollero, E, H. Prade, F, E. H. Ruspini, USA, E. Sanchez, F, Ph. Smets, B, N. Teodorescu, ROM, A. Titli, F, I. B. Turksen, CAN, H.B. Verbruggen, NL, J. L. Verdegay, E, R.R. Yager, USA, T. Yamakawa, J, M. Zemankova, USA Organization Committee Chairman: K. Lieven Secretary:K. Besting, U. Hollinde-Steininger Software demonstrations:J. Angstenberger Software & book exhibition:H. Brning Treasurer:S. Scheffer Working groups:R. Weber Conference Secretariat EUFIT '93 Prof. Dr. Dr. h.c. H.-J. Zimmermann Promenade 9, Korneliuscenter 5100 (after July 1, 1993: 52076) Aachen, Germany Phone:+49/2408/6969 Fax:+49/2408/94582 Welcome by the General Chairman Prof. Dr. Dr. h.c. H.-J. Zimmermann, Aachen Institute of Technology, ELITE-Foundation, Germany As the General Chairman of EUFIT '93 it is a pleasure to welcome the participants of this Conference in Aachen where the charm of 1200 years of history merges with most advanced technological research performed in the "RWTH", the largest European Institute of Technology with almost 40 000 students and six different Colleges of Engineering. The last two decades have witnessed a very strong growth of theoretical areas related to Fuzzy Set Theory and Neural Networks. Since the beginning of the seventies these techniques have also been applied to a variety of problems. To an increasing degree they are merged with other approaches in the area of "Intelligent Techniques". "Intelligent Techniques" is not a crisply defined area. It includes Fuzzy Logic as well as Neural Networks, Genetic Algorithms, Tabu- Search, Expert Systems Technology as well as Data Analysis and Control Theory. It is therefore not surprising that numerous disciplines have contributed to this area such as Artificial Intelligence, Operations Research, Decision Theory, Logics, Psychology, Computer Science and, of course, Mathematics. In addition to the problems caused by the interdisciplinary approach, Europe is characterized by a number of features which lead to additional problems, but also to additional challenges and additional potentials: the multi-cultural and multi-lingual environment in Europe makes communication between the different countries difficult, expensive and time-consuming. There exists the danger that the wheel is invented several times at different locations in Europe and that overall research efficiency in Europe decreases compared to other continents. Therefore it seems to be of particular importance in Europe to facilitate and strengthen communication and cooperation between scientists and practitioners in different European countries. This is exactly what EUFIT '93 wants to achieve. The scope of this Conference is large in order to accommodate the needs of newcomers to the area of intelligent systems as well as those who have already been working in this area for a long time. Tutorials provide a basic background and plenary presentations, panel sessions, invited and contributed sessions, working groups etc. shall be of benefit to researchers and appliers in the various scientific and economic areas. Aachen lends itself as a location for this Conference for several reasons: it is a city which is used to interdisciplinary research of engineering science and social science faculties; it is a city in which the cultures of Belgium, the Netherlands and Germany merge and a city which is very friendly, hospitable and open minded. Aachen is also a location where active research of various kinds has been performed in the area of Fuzzy Set Theory since the beginning of the seventies, with the university in which theory and applications of Fuzzy Sets have been taught on a regular basis since the beginning of the eighties and it is also the location of ELITE, the European Laboratory for Intelligent Techniques Engineering which has as the main goal to advance and facilitate the European cooperation in the area of Intelligent Techniques. I am most thankful to all members of the Programme Committee and the Organization Committee for their continued help and support. A special recognition goes to the staff of ELITE and MIT without whose enthusiastic activities this Conference would not have been possible. I am also most thankful to all the colleagues that have agreed to offer tutorials, to all speakers at the Conference and, of course, to all participants that have come to Aachen and that will make of this Conference the first successful European conference in the area of Fuzzy and Intelligent Systems. I hope you all will benefit from this event, enjoy your stay in Aachen and return to Aachen very often in the future. H.-J. Zimmermann Scientific Programme General overview The EUFIT '93 - First European Congress on Fuzzy and Intelligent Technologies from September 7-10, 1993 has four parts: Tutorials (September 7) Conference presentations (September 8-10) Poster presentations (September 8-10) Exhibition of products, software, hardware, books (September 8- 10). The tutorials are offered as an introduction for newcomers to the area. The lectures will be presented by reputed researchers and recognized practitioners. The tutorials will facilitate the understanding of the presentations of the conference. The conference is composed by plenary, semi-plenary, ordinary sessions, poster sessions and panel discussions. There are 48 technical and application oriented sessions each of them with 3-4 presentations by leading scientists and practitioners. The programme committee decided to set up 5 poster sessions with contributions which cannot be presented by talks. The exhibition will show products, software, hardware and books related to the conference topics. In the following there are abstracts given for the tutorials. The conference schedule is described by the title of the sessions and their organizers. If you need more information about the detailed programme, please, contact the congress organizers. Tutorials AFuzzy Control: Theory and Applications Hamid Berenji, NASA Ames Research Center, USA Tuesday, September 7, 1993, 9.00 to 12.30 hours This course discusses the recent techniques developed in the fields of fuzzy logic and artificial neural networks as applied to control of physical systems. The basics of neurocontrol and fuzzy control, as well as the methods that they can complement the more analytical approaches of control theory, will be discussed. A number of very successful applications of fuzzy control especially in Japan has introduced this technology as a practical tool for all engineers involved in the design of control systems and other systems in which their designers need to incorporate artificial intelligence. This tutorial will also discuss the recently developed approaches in combining fuzzy control with the reinforcement learning techniques of neural networks. Berenji's ARIC and GARIC architectures will be fully discussed during this course. Also, the recent applications of clustering methods in development of fuzzy logic rules from data will be discussed. BFuzzyness In Database Management Systems Patrick Bosc, IRISA/ENSSAT, France Tuesday, September 7, 1993, 9.00 to 12.30 hours The subject is situated at the confluence of two important areas which are evolving very rapidly: The management of information using computer systems (database management systems) on the one hand and the applications of fuzzy logic and possibility theory on the other hand. We will first recall the main notions related to databases and fuzzy sets and then introduce the two major joining points between these two domains: i) when one wants to store and manipulate data tainted with imprecision and/or uncertainty and ii) when one wants to address queries involving some imprecision in the terms (flexible querying). These two aspects will then be detailed and we will especially present how ill-known values can be represented in a database and the main components of fuzzy queries. The next part of the presentation will be dedicated to flexible queries addressed to regular databases. This special case is interesting, since it offers some prospects for enlarging the capabilities of present database management systems. Some solutions have been proposed without recalling on the fuzzy set framework and we will compare them to fuzzy query oriented approaches. The principal features of an extension to an SQL query language so as to support fuzzy queries will be given and the issue of query equivalences will be discussed. Finally, the last point will concern the implementation aspects, and the ways to process fuzzy queries as efficiently as possible in a generalized querying system. In the concluding part, we will attempt to point out the advantages of the fuzzy set and possibility theory framework as well as the features that could be introduced in commercial products in the near future. CPattern Recognition With Fuzzy Sets And Neural Nets James C. Bezdek, University of West Florida, USA Tuesday, September 7, 14.00 to 17.30 hours Fuzzy sets were introduced by Zadeh in 1965 to represent and manipulate data and information that possess non-statistical uncertainty. Computational Neural Networks were first discussed by McCullough and Pitts in 1943 as a means for imitating the power of biological systems for data and information processing. This four hour tutorial covers the basic ideas of these two technologies - fuzzy models and computational neural networks; and their use for selected applications in pattern recognition. The first section discusses the basic theory of fuzzy sets and generalizations of Zadeh's original ideas which have become important in the last two decades. The second section describes the basic ideas of pattern recognition. Section three accounts for several well-known fuzzy models for clustering and classifier design. Section four provides an overview of fuzzy logic and Kohonen-type clustering networks. The last section is devoted to biological and computational neural networks, and their relationship to fuzzy classifier networks and statistical classifier designs. DChaos Theory and Fuzzy Sets Horia-N. Teodorescu, Polytechnic University of Iasi, Romania Tuesday, September 7, 14.00 to 17.30 hours Classic systems can show chaotic behavior, i.e. a chaotic trajectory in an Euclidian space. Similarly, but at a higher complexity level, fuzzy systems can show chaotic behavior, represented by a chaotic trajectory in a space of functions (membership functions space). Such a behavior is named chaotic fuzziness. The tutorial adresses four main topics, namely i) what fuzzy chaotic fuzziness is; ii) how chaos can occur in fuzzy logic and fuzzy algebraic systems; iii) how complex the chaos in fuzzy systems can be; iv) chaos in fuzzy control systems and possible applications of chaos in fuzzy systems. The tutorial stresses on the last two points. Ways to build both logic and algebraic fuzzy systems exhibiting chaotic behavior, and also ways to avoid chaos in fuzzy systems, when the chaotic behavior is not desired, are presented from an engineering point of view. All presented topics are fully exemplified. EGenetic Algorithms And Fuzzy Sets Elie Sanchez, Institut Mditerranen de Technologie, France Tuesday, September 7, 14.00 to 17.30 hours Genetic Algorithms (GAs) are first introduced for new comers to the field. GAs are optimization and machine learning algorithms inspired from natural evolution. They operate on strings of bits called chromosomes (chromosomes can also be real numbers or permutations of elements). To solve a problem using Genetic Algorithms, its solutions have first to be encoded on chromosomes and an evaluation function (or objective function - fitness function for the biologists) has to be defined in order to measure the performance, or goodness, of the chromosomes. Genetic Algorithms consist in copying strings and swapping parts of the strings: this is basically processed by means of three operators: Reproduction, Crossover and Mutation. It will be presented the relationships of GAs with Artificial Neural Networks and then with Fuzzy Logic Based Systems. Hybridization of Genetic Algorithms with Neural Networks is focused on weighting. In a fixed neural network architecture, the Genetic Algorithm searches for well-adapted sets of weights (chromosomes are lists of weights) and evaluation consists in running the network over a training set of examples. GAs are also used to learn membership functions of fuzzy parameters and to select IF-THEN rules in fuzzy logic systems based on rules of inference, like expert systems, or in fuzzy control. GAs hybridized with neural networks and fuzzy logic techniques constitute a new area for promising research. Due to the successful applications achieved in these three domains, it is very likely that they will reinforce each other and that many developments will emerge in a near future, in particular in learning fuzzy control systems. F Neuroinformatics Rolf Eckmiller, University of Bonn, Germany Tuesday, September 7, 9.00 to 17.00 hours This tutorial is intended to give in a first part the basics on Neural systems and their applications. The main topics are: Learning-driven neural computers versus software-driven von Neumann computers Research programmes and typical applications of neural networks world-wide Information processing in biological neural systems Principles of technical neural networks (with computer demonstration of learning) Specific neural networks for various applications in robotics and control. In a second part there will be poster sessions with computer- animation (Sun and PC) to the following topics: Neural networks for storage and retrieval of trajectories Neural networks for path planning and obstacle avoidance Neural networks for inverse kinematics of robot control Neural networks for stable dynamic robot control Neural networks for adaptive load distribution in MIND-computers. GFuzzy Technology - Basic Principles Hans-Jrgen Zimmermann, Aachen Institute of Technology, Elite-Foundation, Germany Tuesday, September 7, 9.00 to 17.00 hours This Tutorial is intended for newcomers to the area of fuzzy technology. In the last three decades 15 000 to 16 000 publications have appeared in this area. This makes it quite difficult for newcomers to get acquainted with the most important parts of the theory and its applications. On the other hand sufficient knowledge of fuzzy set theory is a prerequisit for following and understanding most of the research contributions of the Conference. It is also a necessary condition for good applications of this theory. This tutorial will offer a structured view on the area of fuzzy technology. It will first introduce problems and possibilities of uncertainty modelling. The basic principles of fuzzy set theory will then be presented from different angles. Applications will be shown from the areas of model-based uses of fuzzy sets, from knowledge based user, such as expert systems, and fuzzy control, and in the area of (fuzzy) data analysis. Finally the status of fuzzy set theory and its applications in Europe, Japan, and the USA will be sketched. Scientific Programme Wednesday, September 8, 1993 8.30 Registration 9.00 Start of Exhibition (software, hardware, produc